method for detecting a target nucleic acid sequence and kit for detecting a target nucleic acid sequ

专利摘要:
"TSG INITIATOR TARGET DETECTION". The present invention relates to the detection of a target nucleic acid sequence in real time using a target signal generation primer (TSG primer) having dual interactive markers. The present invention allows for both target amplification and signal amplification by introducing dual interactive markers in a primer used in PCR reactions, ensuring real-time target detection by PCR reactions without the use of complicated oligonucleotides. The present invention can be free from the uncomfortable materials and flaws associated with conventional real-time PCR methods. The present invention allows successful target detection in real time using only a labeled primer. Also, the present invention can obtain strong signals indicative of the presence of the target nucleic acid sequences in both a liquid and a solid phase.
公开号:BR112012018394B1
申请号:R112012018394-0
申请日:2010-03-26
公开日:2021-02-23
发明作者:Jong Yoon Chun
申请人:Seegene, Inc；
IPC主号:

专利说明:

BACKGROUND OF THE INVENTION FIELD OF THE INVENTION
[0001] The present invention relates to the detection of a target nucleic acid sequence using a target signal generation primer (TSG primer). DESCRIPTION OF RELATED TECHNIQUE
[0002] A target nucleic acid amplification process is prevalently involved in most technologies for detecting target nucleic acid sequences. The amplification of nucleic acids is a fundamental process of a wide variety of methods in molecular biology, such that several methods of amplification have been proposed. For example, MIller, H. I. et al. (WO 89/06700) amplified a nucleic acid sequence based on the hybridization of a promoter / primer sequence to a single stranded target DNA ("ssDNA") followed by the transcription of many RNA copies of the sequence. Other known nucleic acid amplification procedures include transcription-based amplification systems (Kwoh, D. et al., Proc. Natl. Acad. Sci. USA, 86: 1173 (1989); and Gingeras TR et al., WO 88 / 10315).
[0003] The most prevalent process for nucleic acid amplification known as the polymerase chain reaction (hereinafter referred to as "PCR") is based on repeated cycles of double-stranded DNA denaturation, followed by oligonucleotide primer annealing to the DNA template, and extension of primer by a polymerase DNA (Mullis et al. US Patent Nos. 4,683,195, 4,683,202, and 4,800,159; Saiki et al., (1985) Science 230, 1350- 1354).
[0004] PCR-based techniques have been widely used not only for the amplification of a target DNA sequence, but also for scientific applications or methods in the fields of biological and medical research, such as reverse transcriptase PCR (RT-PCR), Differential display PCR (DD-PCR), cloning of known or unknown genes by PCR, rapid amplification of cDNA ends (RACE), PCR with arbitrary primers (AP-PCR), multiplex PCR, SNP genome typing, genomic analysis PCR-based (McPherson and Moller, (2000) PCR. BIOS Scientific Publishers, Springer-Verlag New York Berlin Heidelberg, NY).
[0005] At the same time, the methods for detecting target nucleic acids based on the proposed nucleic acid amplification so far are summarized as follows: 1. Post-PCR Detection Method
[0006] The post-PCR method which is typically heterogeneous involves the amplification of nucleic acids and then the detection of amplified products for analysis of the target sequence of nucleic acids. The conventional post-PCR detection method requires that amplified products be separated based on a size differential, which is commonly achieved by using gel electrophoresis, or by immobilizing the product. However, the separation process causes serious problems such as transferring contamination and low yield. 2. Real-time detection methods
[0007] To overcome problems with the post-PCR method, a real-time PCR method that detects amplified products in real time and was contaminant-free was suggested, making it possible to quantitatively analyze the target nucleic acid sequences. 2.1 Methods based on marked primer 2.1.1 Sunrise initiator method
[0008] This method uses Sunrise primers that form clamp loops at their 5 'ends to join a fluorophore and fluorescence inhibitor pair, thereby ensuring low fluorescence. When these primers were incorporated into a PCR product, the tails become double-stranded and the clamp is untangled causing the fluorescence to increase (Nazarenko et al, 2516-2521 Nucleic Acids Research, 1997, v.25 n. 12, and Pat US No. 6,117,635). However, the Sunrise primer method is very inconvenient in that the primers are intricately designed to contain a sequence complementary to target nucleic acid sequences and a sequence capable of forming clip loops at its 5 'ends. In addition, the existence of clamp loops in primers deteriorates their hybridization efficiency for target sequences. 2.1.2 Scorpion initiator method
[0009] This method uses Scorpion initiators containing an integrated signaling system. The primer has a template binding region and the tail comprising a linker and a target binding region. The binding target region is hybridized to a complementary sequence in a primer extension product. Subsequently, this specific hybridization target event is coupled to a signaling system in which the hybridization leads to a detectable modification. The ligand in the tailed primer prevents polymerase-mediated chain copying of the tail region of the primer template (Whitcombe et al, 804-807, Nature Bio-technology v.17 AUGUST 1999 and US Pat. No. 6,326,145) . Like the Sunrise primer method, this tailed primer also has a difficulty in primer design and synthesis due to the incorporation of a ligand to generate amplicon-dependent signals and a hybridizable binding target region with a primer extension product in a primer . In addition, the existence of clip handles on primers reduces their hybridization efficiency to target sequences. 2.1.3 Marked single primer method (Lux method)
[00010] The single labeled primer method uses primers with a single fluorescence label to detect target sequences by observing changes in fluorescence characteristics in primers to hybridize to target sequences (U.S. Pat. No. 7,537,886). It is also recommended for this method that the initiators have a clamp-loop structure for efficient signal generation. In addition, the fluorescence characteristics in primers can be altered by several factors, such as types of markers, primer sequences around the fluorescence marker, the position of the fluorescence marker in primers and surrounding other components, making it very difficult to optimize the design of the initiator. 2.1.4. Lion method (using 3 ’to 5’ nuclease activity)
[00011] This method uses a deliberately incompatible labeled primer on at least one nucleotide at the 3 'end of the primer. The labeled primer is incubated with a sample under conditions sufficient to allow hybridization and the sample is subsequently exposed to the nucleic acid polymerase which has a 3 'to 5' revision activity, thereby releasing the marker or part of the marker system ( US Pat. No. 6,248,526).
[00012] However, the incompatible primer must be intricately designed to contain an incompatible nucleotide at its 3 'end. To make matters worse, the incompatible primer is likely to generate false positive signals by activity 3 'to 5' of revision even when the 3 'end is incompatible for non-target sequences. 2.2 Methods based on marked probe 2.2.1 Molecular beacon method
[00013] Molecular beacons contain fluorescent dyes and inhibitors, but FRET (fluorescence resonance energy transfer) only occurs when the fluorescence inhibiting dye is directly adjacent to the fluorescent dye. Molecular headlamps are designed to adopt a staple structure while released in solution, leaving both dyes very close. When a molecular beacon hybridizes to a target, the fluorescent dyes and fluorescence inhibitors are separated. FRET does not occur and the fluorescent dye emits light under irradiation (Indian J Med Res 124: 385-398 (2006) and Tyagi et al, Nature Biotechnology v.14 MARCH 1996).
[00014] However, there are some disadvantages to the molecular beacon method.
[00015] First, two reverse repeats of the clamp structure must have complementary counterparts in the target nucleic acid, which in turn requires the presence of reverse repeats in the target as well, a condition that is not generally found. Second, the Tm of the loop portion of the clamp structure with a complementary nucleic acid sequence and the Tm of the stem portion must be carefully balanced with respect to the assay temperature to allow specific deployment of the clamp probe in the presence of the target without nonspecific breakdown. Finally, this method requires additional primers to amplify the target nucleic acid sequences. 2.2.2 Hybridization probe methods
[00016] This method uses four oligonucleotides: two primers and two probes. The hybridization probes have a unique marker, one with a donor fluorophore and one with an acceptor fluorophore. The sequence of the two probes is selected so that they can hybridize the target sequences in a head-to-tail arrangement, leaving the trailer dyes very close together, allowing the transfer of fluorescence resonance (FRET) energy. The acceptor dye in one of the probes transfers the energy, allowing the other to dissipate the fluorescence at a different wavelength. The amount of fluorescence is directly proportional to the amount of target DNA generated during the PCR process (385-398, Indian J Med Res 124, review article October 2006 and 303-308, and Bernad et al, 147-148 Clin Chem 2000 ; 46).
[00017] However, this method is not adopted for multiplexing the detection and requires additional primers to amplify the target nucleic acid sequences. 2.2.3 TaqMan probe method (using nuclease activity 5 ’to 3’)
[00018] TaqMan probes are designed to hybridize an internal region of a PCR product. During PCR, when the polymerase replicates a template to which a TaqMan probe is attached, the 5 'activity of the exonuclease polymerase cleaves the probe. This separates fluorescent dyes and fluorescence inhibitors and FRET no longer occurs (385-398, Indian J Med Res 124, review article October 2006 and 303-308, U.S. Pat. No. 5,210,015).
[00019] However, this method is limited in the sense that it employs three oligonucleotides (a dual label probe and two primers). This seriously complicates the design and synthesis of the probe, and the optimization of the reaction condition. 2.2.4. Fluorescence self-inhibiting probe method (using 5 ’to 3’ nuclease activity)
[00020] The fluorescence autoinhibitory probe method uses dual labeled probes that have a hybridizable sequence with an internal region of a PCR product (U.S. Pat. No. 5,723,591).
[00021] Probably for the TaqMan method, the fluorescence self-inhibiting probe method has to use three oligonucleotides (a dual labeled probe and two primers) for the homogeneous assay, which makes it seriously complicated to optimize the probe design and conditions reaction.
[00022] As described above, most of the conventional target detection methods developed so far have intrinsic flaws that are considered difficult to overcome.
[00023] Consequently, there is a long-felt need for a new approach for detecting target nucleic acid sequences in a more technical and more time- and cost-efficient manner.
[00024] Throughout this patent application, several patents and publications are referred to, and citations are provided in parentheses. The disclosure of these patents and publications in their entities is hereby incorporated by references in this patent application in order to more fully describe this invention and the state of the art to which this invention belongs. SUMMARY OF THE INVENTION
[00025] The present inventors have done intensive research to overcome flaws associated with conventional technologies for the real-time detection of target nucleic acid sequences. The present inventors invented new TSG (target signal generation) primers capable of generating signals depending on hybridization and extension with the target nucleic acid sequences, and in turn built several protocols using the primers to detect the target nucleic acid sequences . As a result, we found that the new protocols or processes exhibit plausible performance in detecting target nucleic acid sequences, inter alia, real-time detection, and produce signals indicative of the presence of the target nucleic acid sequences both in a liquid phase and in a solid phase much stronger and faster.
[00026] Consequently, it is an object of this invention to provide a method for detecting a target nucleic acid sequence from a DNA or a mixture of nucleic acids using a target signal generation primer (TSG primer).
[00027] It is another object of this invention to provide a method for detecting a target nucleic acid sequence from a DNA or a mixture of nucleic acids using a target signal generation primer (TSG primer) in an amplification reaction .
[00028] It is an additional object of this invention to provide a kit for detecting a target nucleic acid sequence from a DNA or a mixture of nucleic acids using a target signal generation primer (TSG primer).
[00029] Other objects and advantages of the present invention will be evident from the detailed description below taken in conjunction with the added claims and drawings. BRIEF DESCRIPTION OF THE DRAWINGS
[00030] The basic principles of the present invention are outlined in FIG. 1 to 4.
[00031] FIG. 1 shows the schematic steps involved in an assay for detecting a target nucleic acid sequence using a TSG primer. FIG. 1A shows the use of a TSG primer having a conventional structure for detecting a target nucleic acid sequence. FIG. 1B shows the use of a TSG primer that has a dual initiation oligonucleotide (DPO) structure for primer annealing specificity in detecting a target nucleic acid sequence.
[00032] FIG. 2 shows a schematic representation of a real-time PCR amplification for the detection of a target nucleic acid in real time using a TSG primer of this invention and a template-dependent polymeric nucleic acid that has no 5 'to 3 nuclease activity '. FIG. 2A shows the use of a TSG primer having a conventional structure of real-time PCR amplification. FIG. 2B shows the use of a TSG primer having a dual initiation oligonucleotide (DPO) structure for the primer specificity in a real time PCR amplification.
[00033] FIG. 3 shows a schematic representation of a real-time PCR amplification for the detection of a target nucleic acid in real time using a TSG primer of this invention and a mold-dependent polymeric nucleic acid having a 5 'to 3' nuclease activity . FIG. 3A shows the use of a TSG primer having a conventional structure of real-time PCR amplification. FIG. 3B shows the use of a TSG primer having a dual initiation oligonucleotide (DPO) structure for the primer specificity in a real time PCR amplification.
[00034] FIG. 4 shows the schematic steps involved in an assay for detecting a target nucleic acid sequence using a TSG primer immobilized on the solid substrate. FIG. 4A shows the use of a TSG primer having a conventional structure for detecting a target nucleic acid sequence. FIG. 4B shows the use of a TSG primer having a dual initiation oligonucleotide (DPO) structure for primer annealing specificity in detecting a target nucleic acid sequence.
[00035] FIG. 5 shows the results of detection of S. pneumoniae only by hybridization and extension of TSG primers during the nucleic acid synthesis reaction using a mold-dependent DNA polymerase that has no exonuclease activity 5 'to 3' without repeated denaturation , hybridization and primer extension.
[00036] FIG. 6 shows the results of detection of S. aureus only by hybridization and extension of TSG primers during the nucleic acid synthesis reaction using a mold-dependent DNA polymerase that has no exonuclease activity 5 'to 3' without repeated denaturation, hybridization and launcher extension.
[00037] FIG. 7 shows the results of real-time PCR amplification for the detection of S. pneumoniae using TSG primers and a template-dependent DNA polymerase that has no 5 'to 3' exonuclease activity.
[00038] FIG. 8 shows the results of real-time PCR amplification for the detection of S. aureus using TSG primers and a template-dependent DNA polymerase that has no 5 'to 3' exonuclease activity.
[00039] FIG. 9 shows the results of real-time PCR amplification for the detection of N. gonorrhoeae using TSG primers and a template-dependent DNA polymerase that has no 5 'to 3' exonuclease activity.
[00040] FIG. 10 shows the results of real-time PCR amplification for the detection of N. meningitidis using TSG primers and a template-dependent DNA polymerase that has no 5 'to 3' exonuclease activity.
[00041] FIG. 11 shows the results of real-time PCR sensitivity for the detection of S. aureus using a TSG primer and a mold-dependent DNA polymerase that has no 5 'to 3' exonuclease activity.
[00042] FIG. 12 shows the results of signal generation and accumulation of TSG primers depending on a mold-dependent nucleic acid polymerase having a 5 'to 3' nuclease activity or that has no 5 'to 3' nuclease activity during the synthesis reaction nucleic acids with repeated denaturation, hybridization and primer extension.
[00043] FIG. 13 shows the results of real-time PCR amplification for the detection of S. pneumoniae using TSG primers and a template-dependent DNA polymerase having 5 'to 3' exonuclease activity.
[00044] FIG. 14 shows the results of real-time PCR amplification for the detection of S. aureus using TSG primers and a template-dependent DNA polymerase having 5 'to 3' exonuclease activity.
[00045] FIG. 15 shows the results of real-time PCR amplification for the detection of N. gonorrhoeae using TSG primers and a template-dependent DNA polymerase having 5 'to 3' exonuclease activity.
[00046] FIG. 16 shows the results of real-time PCR amplification for the detection of N. meningitidis using TSG primers and a template-dependent DNA polymerase having 5 'to 3' exonuclease activity.
[00047] FIG. 17 shows the results of real-time PCR sensitivity for the detection of S. aureus using a TSG primer and a template-dependent DNA polymerase having 5 'to 3' exonuclease activity. DETAILED DESCRIPTION OF THIS INVENTION
[00048] The present invention is directed to a new method for detecting a target nucleic acid sequence in real time using a target signal generation primer (TSG primer) with a dual marker system and a polymerase dependent nucleic acid mold.
[00049] According to the present invention, the dual labeled primer called a target signal generation primer (TSG primer) with inhibitory signals is hybridized to a target nucleic acid sequence to induce non-inhibition of signal and extended to synthesize. - use a sequence complementary to the target nucleic acid sequence, finally detecting the signal indicating the presence of the target nucleic acid sequence. In other words, the TSG primer undergoes both conformational modification of the non-inhibited signal and the 3 'extension reaction.
[00050] The present inventors first found that as a primer without any modified structure, such as a loop-loop structure, the TSG primer can generate target signals by converting an inhibiting state to a non-inhibiting state depending on the extent and hybridization of the initiator. TSG initiators and the processes in real time using them were first proposed by the present inventors.
[00051] One of the key advantages of the TSG initiator is that the extension at the 3 'end of the TSG initiator ensures much less variation in signal strength in changing reaction conditions (eg reaction temperatures), leading us to to reason that more reliable and stable signal results can be obtained by extending the 3 'end of the TSG primer with very little or no signal influence on the reaction condition modification. In particular, the extension at the 3 'end of the TSG primer allows the TSG primer to amplify the target nucleic acid sequence.
[00052] The TSG primer of the present invention in amplification reactions, inter alia, in real-time detection methods based on PCR, is involved in target amplification as well as signal generation, allowing for a successful homogeneous assay for target sequences.
[00053] Interestingly, the new real-time PCR detection method of the present invention using TSG primers works in a distinctly different way from conventional real-time PCR approaches, resulting in overcoming the disadvantages of conventional technologies and elevating of real-time detection efficiency.
[00054] The most notable difference between the TSG primer-based method and conventional probe-based methods, such as molecular beacon and TaqMan probe methods, is that the labeled probes are only capable of generating target signals not to amplify target sequences, but TSG primers are capable of amplifying target sequences as well as generating target signals. The probe-based methods are compelled to use additional primers for the target amplification, which clearly differ from the present invention. It would be recognized by one skilled in the art that conventional methods using labeled probes go through probe and primer design, sequence selection and reaction optimization because additional primers for amplification are required. In contrast, since the TSG primer method does not require additional probes, such problems can be minimized.
[00055] In addition, since TSG primers are incorporated into expanded or amplified products, but labeled probes are not incorporated into any product, the TSG primer method directly measures amplified products, but cannot be considered that the signals from the marked probe method directly reflect the amplified products.
[00056] In addition, hybridization of labeled probes with target sequences is dependent on concentrations of labeled probes and amplified products, which makes it difficult to perform quantitative analysis. Although over-labeled probes can be used to improve the accuracy of quantitative analysis, they are very likely to produce major background problems. In contrast, the TSG primer method can directly measure target amplification using labeled primers, allowing for quantitative analysis of target sequences with much higher accuracy.
[00057] At the same time, several methods of real-time detection based on conventional primers, such as the Sunrise method and Scorpion method have to form a clamp structure to inhibit their fluorescence prior to hybridization with target sequences.
[00058] However, the use of the clamp structure in methods based on labeled primers reduces the amplification efficiency as well as the hybridization efficiency. In addition, the clamp structure configured for the marked primers requires an additional sequence; therefore, primers have to be designed and prepared considering both a complementary target sequence and a sequence that forms the clamp. In these contexts, it would be difficult to design the primers marked with the clamp structure. In contrast, the TSG initiator generates target signals without the aid of clamp structures, and allows to overcome failures associated with clamp structures.
[00059] The Lux method using a unique marker in primers is different from the present invention using a dual interactive marker system in primers in view of a main mechanism that is the basis of signal generation. The signal of the single marker molecule in primers can be affected by several factors, such as types of markers, primer sequences around the marker, the positions of the marker in primers and surrounding other components, which are considered disadvantages of the Lux method.
[00060] As described above, the real-time detection method based on the TSG primer of the present invention has some technical attributes (particularly, signal generation principle, oligonucleotide structure and oligonucleotide function) differing from methods based on conventional and probe primer. The technical attributes of this invention allow to overcome the limitations of conventional methods in real time and detect target nucleic acid sequences much more effectively.
[00061] Surprisingly, the present inventors have found that primers hybridized to the target nucleic acid sequences undergo a 5 'cleavage reaction at their 5' end portion by a mold-dependent nucleic acid polymer having 5 'nuclease activity for 3 'and the 5' cleavage reaction adopts for target sequence detection by generating target sequence signals (see PCT / KR2009 / 007064).
[00062] Where the TSG primer having a fluorescence reporter or inhibitor molecule at its 5 'end portion is hybridized to a target sequence (i.e. template), it undergoes a 5' cleavage reaction at its end portion 5 'by a mold-dependent nucleic acid polymerase which has a 5' to 3 'nuclease activity and the reporter and fluorescence inhibitory molecules are then separated from each other, contributing to transmit non-inhibition in the TSG primer.
[00063] It is believed that the proportion of TSG primers to undergo the 5 'cleavage reaction is varied depending on a 5' to 3 'nuclease activity of a mold-dependent nucleic acid polymerase, reaction conditions and distance between a molecule reporter and a fluorescence-inhibiting molecule.
[00064] Whereas the 5 'cleavage reaction occurs in the present invention when the mold-dependent nucleic acid polymerase having 5' to 3 'nuclease activity and the TSG primers having a fluorescence reporter or inhibitor molecule in its 5 end portion 'is used, the present invention can give the signal indicating the presence of the target nucleic acid sequences in two other ways: (i) transmission of the generation by the non-inhibiting signal of the interactive marker system in the TSG primer caused by the conformation modification in hybridization to the target nucleic acid sequence; and (ii) signal generation by 5 'cleavage reaction at its 5' end portion of the TSG primer by the mold-dependent nucleic acid polymerase having 5 'to 3' nuclease activity.
[00065] In the present invention, using the mold-dependent nucleic acid polymerase having 5 'to 3' nuclease activity, it is preferred that the 5 'cleavage reaction occurs only when the 5' end portion (more preferably, the 5 'end) ) of the TSG primer is complementary to the target nucleic acid sequence.
[00066] In accordance with the present invention, target nucleic acid sequences can be detected in real time with dramatically increased efficiency and reliability. To the best of our knowledge, these scientific findings and technological strategies are first proposed by the present inventors.
[00067] In one aspect of the present invention, a method is provided for detecting a target nucleic acid sequence from a DNA or a mixture of nucleic acids using a target signal generation primer (TSG primer), which comprises the steps of:
[00068] (a) hybridizing the target nucleic acid sequence to the TSG primer; wherein the TSG primer comprises (i) a hybridizing nucleotide sequence complementary to the target nucleic acid sequence and (ii) a reporter molecule and a fluorescence inhibitory molecule; wherein when the TSG primer is not hybridized to the target nucleic acid sequence, the reporter molecule and the fluorescence-inhibiting molecule are three-dimensionally adjacent to each other to allow the fluorescence-inhibiting molecule to inhibit a signal from the reporter molecule; where when the TSG primer is hybridized to the target nucleic acid sequence, the reporter molecule and the fluorescence-inhibiting molecule are three-dimensionally separated to allow the fluorescence-inhibiting molecule not to inhibit the signal from the reporter molecule, whereby the signal indicative of the presence of the target nucleic acid sequence is generated and obtained;
[00069] (b) contacting the resultant from step (a) with a mold-dependent nucleic acid polymerase under primer extension conditions such that the 3 'extension reaction is induced at the 3' end of the TSG primer; and
[00070] (c) detection of the signal indicating the presence of the target nucleic acid sequence, whereby the signal indicates the presence of the target nucleic acid sequence in DNA or mixture of nucleic acids.
[00071] The present inventors have done intensive research to overcome the flaws associated with conventional technologies for real-time detection of target nucleic acid sequences. The present inventors invented new TSG (target signal generation) primers capable of generating signals depending on hybridization and extension with the target nucleic acid sequences, and in turn built several protocols using the primers to detect the target nucleic acid sequences . As a result, we have found that the new protocols or processes exhibit plausible performance in detecting target nucleic acid sequences, inter alia, real-time detection, and produce signals indicative of the presence of the target nucleic acid sequences in both a liquid phase and in a solid phase much stronger and faster.
[00072] According to the present invention, the TSG primer to be hybridized to the target nucleic acid sequence has an interactive marker system containing a reporter molecule and a fluorescence inhibitory molecule. Where the TSG primer is not hybridized to the target nucleic acid sequence, the reporter molecule and the fluorescence-inhibiting molecule in the TSG primer are three-dimensionally adjacent to each other to allow the fluorescence-inhibiting molecule to inhibit a signal from the reporter molecule ; on the contrary, when the TSG primer is hybridized to the target nucleic acid sequence, the reporter molecule and the fluorescence-inhibiting molecule in the TSG-primer are three-dimensionally separated to allow the fluorescence-inhibiting molecule not to inhibit the molecule's signal re-reporter, by which the signal indicating the presence of the target nucleic acid sequence is generated and obtained. As such, the TSG primer has a distinct dual function: (i) signal generation for the target nucleic acid sequence; and (ii) synthesis of a sequence complementary to the target nucleic acid sequence.
[00073] Therefore, the primer used in the present invention is called a "Target signal generation primer" (TSG primer) and the present method called "Target Detection Assay with TSG Primer".
[00074] According to the present invention, a target nucleic acid sequence is first hybridized to the TSG primer.
[00075] The term used in this application "target nucleic acid", "if target nucleic acid sequence" or "target sequence" refers to a sequence of nucleic acids of interest for detection, which is annealed or hybridized to a initiator under conditions of hybridization, annealing or amplification.
[00076] The term "initiator", as used in this application, refers to an oligonucleotide, which is capable of acting as a starting point for synthesis when placed under conditions where the synthesis of the initiator extension product is complementary a strand of nucleic acids (template) is induced, that is, in the presence of nucleotides and an agent for polymerization, such as DNA polymerase, and at an appropriate temperature and pH. The initiator is preferably single-stranded for maximum amplification efficiency. Preferably, the primer is an oligodeoxyribonucleotide. The primer of this invention can be comprised of naturally occurring dNMP (i.e., dAMP, dGM, dCMP and dTMP), modified nucleotide or unnatural nucleotide. The primer can also include ribonucleotides.
[00077] The initiator must be long enough to initiate the synthesis of extension products in the presence of the polymerization agent. The exact length of the initiators will depend on many factors, including temperature, application, and source of initiator. The term "ringing" or "initiation" as used in this application refers to the juxtaposition of an oligodeoxynucleotide or nucleic acid to a template nucleic acid, whereby the juxtaposition allows the polymerase to polymerize nucleotides into a nucleic acid molecule that is complementary to the acid nucleic template or a portion thereof.
[00078] The term used "hybridization" used in this application refers to the formation of double-stranded nucleic acid from complementary single-stranded nucleic acids. Hybridization can occur between two strands of nucleic acids perfectly matched or substantially matched with some incompatibilities. Complementarity of hybridization may depend on hybridization conditions, particularly temperature.
[00079] There is no desired distinction between the terms "ringing" and "hybridization", and these terms will be used interchangeably.
[00080] The term "TSG primer" used in this application means a primer having the capabilities of self-inhibition and non-self-inhibition and extension. In particular, the TSG primer used in the present invention means a dual labeled primer capable of both synthesizing a sequence complementary to a target sequence and generating signals indicative of the presence of the target nucleic acid sequences in such a way that where not hybridized with the target nucleic acid sequence, induces the inhibition of the interactive marker system; where hybridized to the target nucleic acid sequence, it induces non-inhibition of the interactive marker system, generating the signal indicating the presence of the target nucleic acid sequence.
[00081] The term used in this application "forward sense primer" means a primer (5 'to 3' direction) complementary to a strand of a target nucleic acid sequence aligned in a 3 'to 5' direction. The antisense primer has a sequence complementary to the other strand of the nucleic acid sequence.
[00082] The term used in this application "three-dimensionally adjacent" in conjunction with the reporter molecule and the fluorescence-inhibiting molecule in the TSG primer means that the reporter molecule and the fluorescence-inhibiting molecule are conformationally close together without the help of any intramolecular structure of primers, such as a loop clamp.
[00083] The TSG primer comprises (i) a hybridizing nucleotide sequence complementary to the target nucleic acid sequence and (ii) a dual interactive marker system. The term "complementary" is used in this application to mean that the primers are sufficiently complementary to selectively hybridize a target nucleic acid sequence under designated ringing conditions or stringent conditions, encompassing the terms "substantially complementary" and "perfectly complementary", preferably perfectly complementary.
Alternatively, the TSG primer may further comprise at its 5 'end a non-hybridizing nucleotide sequence not complementary to the target nucleic acid sequence. Preferably, one of the reporter molecule and the fluorescence-inhibiting molecule in the TSG primer is located in the non-hybridizing nucleotide sequence and the other is located in the hybridizing nucleotide sequence. The non-hybridizing nucleotide sequence of the TSG primer preferably does not form the loop-loop structure and is not involved in the formation of an intramolecular structure, such as a loop-loop. The non-hybridizing nucleotide sequence of the TSG primer preferably does not carry any restriction sites.
[00085] Preferably, the TSG primer does not form the clip-loop structure.
[00086] According to a preferred embodiment, the dual marker system is positioned in the target complementary sequence of the TSG primer.
[00087] According to a preferred embodiment, the 5 'end or a 5' end portion of the TSG primer has a sequence perfectly complementary to the target nucleic acid sequence.
[00088] The TSG primer has the interactive marker system containing the reporter molecule and the fluorescence inhibiting molecule.
[00089] The interactive marker system is a signal generation system in which energy is passed non-radioactively between a donor molecule and an acceptor molecule. As a representative of the interactive marker system, the FRET (fluorescence resonance energy transfer) marker system includes a fluorescent reporter molecule (donor molecule) and a fluorescence inhibiting molecule (acceptor molecule). In FRET, the energy donor is fluorescent, but the energy acceptor can be fluorescent or non-fluorescent.
[00090] In another form of interactive marker systems, the energy donor is non-fluorescent, for example, a chromophore, and the energy acceptor is fluorescent. In yet another form of interactive marker systems, the energy donor is luminescent, for example, bioluminescent, chemiluminescent, electrochemiluminescent, and the acceptor is fluorescent.
[00091] Preferably, the signal indicating the presence of the target nucleic acid sequence is generated by dual interactive marker systems, even more preferably the FRET marker system.
[00092] Where the FRET marker is used on the TSG primer, the two markers (the fluorescent reporter molecule and the fluorescence inhibitory molecule) are separated from each other to induce non-inhibition of signal when the TSG primer hybridized with the target nucleic acid sequence is in a stretched conformation. When the TSG primer not hybridized to the target nucleic acid sequence is in a twisted conformation, the two markers are adjacent to each other to induce signal inhibition.
[00093] The terms used in this application "inhibition" and "non-inhibition" have to be interpreted in a relative manner. For example, the term "non-inhibition" can be considered to reduce the efficiency or level of inhibition than the term "inhibition". In other words, the inhibition of the signal from the reporter molecule encompasses the inhibition of the signal as well as a reduction in signal levels compared to no occurrence of the inhibition. In addition, the non-inhibition of the signal from the reporter molecule involves complete recovery of the signal as well as an increase in signal levels compared to the occurrence of the inhibition.
[00094] The signal indicating the target nucleic acid sequence can be obtained by the differences in levels of signal inhibition as described above. For example, where the relative fluorescence intensities of the fluorescent reporter molecule are measured to detect the target nucleic acid, the TSG primer not hybridized to the target nucleic acid sequence shows a relative low fluorescence intensity (an inhibited state) because the fluorescent reporter molecule and the fluorescence inhibitor molecule are, depending on space (or three-dimensionally), adjacent to each other. Where the TSG primer is hybridized to the target nucleic acid sequence, relatively high fluorescence intensity is detected (a state of non-inhibition) because the fluorescent reporter molecule and the fluorescence inhibitor molecule are, depending on space, separated from each other.
[00095] The reporter molecule and the fluorescence inhibitory molecule can be positioned anywhere on the TSG primer as long as the inhibition-non-inhibition exchange occurs.
[00096] According to a preferred embodiment, the reporter molecule and the fluorescence inhibitor molecule are positioned 4 to 50 nucleotides apart.
[00097] According to a preferred embodiment, the reporter molecule and the fluorescence inhibiting molecule are positioned at no more than 50 nucleotides, more preferably not more than 40 nucleotides, even more preferably no more than 30 nucleotides, still very much more preferably not more than 25 nucleotides spaced apart.
[00098] According to a preferred embodiment, the reporter molecule and the fluorescence inhibiting molecule are separated by at least 4 nucleotides, more preferably at least 6 nucleotides, even more preferably at least 10 nucleotides, even more preferably at least 15 nucleotides.
[00099] According to a preferred embodiment, the reporter molecule or the fluorescence inhibiting molecule in the TSG primer is located at its 5 'or 1 to 5 nucleotides end away from its 5' end. For example, the reporter molecule on the TSG primer is located at its 5 'or 1 to 5 nucleotides end away from its 5' end and the inhibitor molecule is located 4 to 50 nucleotides away from the reporter molecule.
[000100] According to a preferred embodiment, the reporter molecule on the TSG primer is located at its 5 'or 1 to 10 nucleotides end away from its 5' end, more preferably at its 5 'end.
[000101] According to a preferred embodiment, the fluorescence-inhibiting molecule in the TSG primer is located at its 5 'or 1 to 10 nucleotides end away from its 5' end, more preferably at its 5 'end.
[000102] The reporter molecule and the fluorescence inhibiting molecule useful in the present invention can include any molecule known in the art. Examples of those are: Cy2 ™ (506), YO-PRO ™ -1 (509), YOYO ™ -1 (509), Calcein (517), FITC (518), FluorX ™ (519), Alexa ™ (520), Rhodamine 110 (520), 5-FAM (522), Oregon Green ™ 500 (522), Oregon Green ™ 488 (524), RiboGreen ™ (525), Rhodamine Green ™ (527), Rhodamine 123 (529), Magnesium Green ™ (531), Calcium Green ™ (533), TO-PRO ™ -1 (533), TOTO1 (533), JOE (548), BO-DIPY530 / 550 (550), Dil (565), BODIPY TMR (568 ), BODIPY558 / 568 (568), BODIPY564 / 570 (570), Cy3 ™ (570), Alexa ™ 5464 (570), TRITC (572), Magnesium Orange ™ (575), R&B phycoerythrin (575), Rhodamine Phalloidin ( 575), Calcium Orange ™ (576), Pyronin Y (580), Rhodamine B (580), TAMRA (582), Rhodamine Red ™ (590), Cy3.5 ™ (596), ROX (608), Calcium Crimson ™ (615), Alexa ™ 594 (615), Texas Red (615), Nile Red (628), YO-PRO ™ -3 (631), YOYO ™ -3 (631), R-Phycocyanin (642), C- Phycocyanin (648), TO-PRO ™ -3 (660), TOTO3 (660), DiD DilC (5) (665), Cy5 ™ (670), Thiadicarbocyanine (671) and Cy5.5 (694). The numeric in parentheses is a maximum emission wavelength in nanometers.
[000103] Suitable reporter / inhibitor pairs are described in a variety of publications as follows: Fluorescence Spectroscopy (Marcel Dekker, New York, 1971); White et al., Fluorescence Analysis: A Practical Approach (Marcel Dekker, New York, 1970); Berlman, Handbook of Fluorescence Spectra of Aromatic Molecules, 2nd Edition (Academic Press, New York, 1971); Griffiths, Color AND Constitution of Organic Molecules (Academic Press, New York, 1976); Bishop, editor, Indicators (Pergamon Press, Oxford, 1972); Haugland, Handbook of Fluorescent Probes and Research Chemicals (Molecular Probes, Eugene, 1992); Pringsheim, Fluorescence and Phosphorescence (Interscience Publishers, New York, 1949); Haugland, R. P., Handbook of Fluorescent Probes and Research Chemicals, 6th Edition, Molecular Probes, Eugene, Oreg., 1996; U.S. Patent Nos. 3,996,345 and 4,351,760.
[000104] It is notable that a non-fluorescent black inhibitory molecule capable of inhibiting fluorescence over a wide range of wavelengths or a specific wavelength can be used in the present invention.
[000105] In the FRET marker adopted for the TSG initiator, the reporter includes a FRET donor and the inhibitor includes the other FRET partner (acceptor). For example, a fluorescein dye is used as a reporter and a rhodamine dye as an inhibitor.
[000106] After hybridization with the target nucleic acid sequence, the resultant from step (a) is contacted with the template-dependent nucleic acid polymerase under primer extension conditions to extend the hybridized TSG primer with the target sequence nucleic acids.
[000107] The phrase "under primer extension conditions" means conditions sufficient to induce the extension reaction at the 3 'end of the TSG primer by a template-dependent nucleic acid polymerase. Such conditions can be conditions of the extension of primer by conventional nucleic acid polymerases. For example, conditions will be found in Joseph Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (2001). As an illustrative example, conditions include incubation of a target nucleic acid sequence, the TSG primer, a thermostable DNA polymerase (for example, Taq DNA polymerase), dNTPs and MgCl2 at a relatively high temperature (for example, 50 to 75oC) for an appropriate period of time.
[000108] The extension of the TSG primer is a crucial step of the present invention. Where the expanded product is produced by the TSG primer extension reaction, it leads to more stable hybridization of the TSG primer sequence incorporated in the expanded product with the target nucleic acid sequence. In addition, the TSG primer extension reaction allows to incorporate markers in the TSG primer in the expanded product, thereby increasing the signal intensity in parallel with the amount of the amplified product. Such coupling phenomenon induced in the present invention ensures more accurate quantitative analysis of the target nucleic acid sequence. According to the present invention, probes improbably labeled, where the TSG primer per se, are not specifically hybridized to non-target sequences, any false positive signal cannot be generated by performing signal detection under high stringent conditions, such as as high temperatures (for example, 50 to 85oC). Also, the extension of the TSG primer results in the amplification of the target nucleic acid sequence, allowing signal amplification simultaneously with target amplification.
[000109] According to the present invention, a mold-dependent polymerase nucleic acid includes any nucleic acid polymerase known in the art.
[000110] One of the prominent advantages of the present invention is to generate target signals even using a mold-dependent nucleic acid polymerase without nuclease activities.
[000111] According to a preferred embodiment, the mold-dependent nucleic acid polymerase used in the present invention has no nuclease activity.
[000112] According to a preferred embodiment, the mold-dependent nucleic acid polymerase used in the present invention has no 5 'to 3' nuclease activity
[000113] The template-dependent nucleic acid polymerase capable of being used in the present invention can include any nucleic acid polymerase, for example, the Klenow fragment of DNA polymerase I from E. coli, a thermostable DNA polymerase and DNA bacteriophage T7 polymerase. Preferably, the polymerase is a thermostable DNA polymerase that can be obtained from a variety of bacterial species.
[000114] According to a preferred embodiment, where the mold-dependent nucleic acid polymerase used in the present invention has a 5 'to 3' nuclease activity, the TSG primer is extended at its 3 'end by the naked acid polymerase activity - mold-dependent kleic polymerase and cleaved at its 5 'end by the 5' to 3 'nuclease activity of the mold-dependent nucleic acid, so that the reporter molecule or the fluorescence-inhibiting molecule is released to generate the signal indicative of presence of the target nucleic acid sequence.
[000115] Preferably, the mold-dependent nucleic acid polymerase having 5 'to 3' nuclease activity is a thermostable DNA polymerase that can be obtained from a variety of bacterial species, including Thermus aquaticus (Taq), Thermus thermophilus, Thermus filiformis , Thermus flavus, Thermus antranikianii, Thermus caldophilus, Thermus chliarophilus, Thermus igniterrae, Thermus lactose, Thermus oshimai, Thermus ruber, Thermus rubens, Thermus scotoductus, Thermus silvanus, Thermus species Z05 and Thermus es-pécies sps 17. Even more preferably , the mold-dependent nucleic acid polymerase having 5 'to 3' nuclease activity is Taq DNA polymerase.
[000116] Interestingly, the present inventors have found that the TSG primer hybridized to the target nucleic acid sequences is extended at its 3 'end and also cleaved at its 5' end portion (e.g., 5 'end) only by contact of the mold-dependent nucleic acid polymerases having 5 'to 3' nuclease activity. The cleavage reaction at the 5 'end portion of the TSG primer is also responsible for signal generation in the present invention.
[000117] In summary, where the present invention is performed to involve the 5 'cleavage reaction of the TSG primer, the present invention can give the signal indicative of the presence of the target nucleic acid sequences in two other ways: (i) generation of signal by the non-inhibition of signal from the interactive marker system in the TSG primer caused by the conformation modification in hybridization with the target nucleic acid sequence; and (ii) signal generation by 5 'cleavage reaction at its 5' end portion of the TSG primer by the mold-dependent nucleic acid polymerase having 5 'to 3' nuclease activity.
[000118] According to a preferred embodiment, the TSG primer comprises a sequence compatible with the target nucleic acid sequence at its 5 'end or at its 5' end portion.
[000119] The term used in this application "5 'end portion" in conjunction with the TSG primer refers to a portion or region comprising any consecutive long sequence of the 5' end of the TSG primer. Preferably, the 5 'end portion of the TSG primer has the 5' end and a sequence comprising 1 to 10 nucleotides (more preferably 1 to 7 nucleotides, even more preferably 1 to 5 nucleotides, even more preferably 1 to 3 nucleotides) away from the 5 'end.
[000120] Alternatively, the mold-dependent nucleic acid polymerase having a 3 'to 5' exonuclease activity can be used in the present invention.
[000121] According to a preferred embodiment, where the template-dependent nucleic acid polymerase having 3 'to 5' exonuclease activity is used, the TSG primer comprises at least one incompatible nucleotide sequence at its 3 'or 3' end portion '.
[000122] According to a preferred embodiment, where the TSG primer comprises at least one incompatible nucleotide sequence at its 3 'end or 3' end portion, the incompatible nucleotide sequence has no marker.
[000123] The number of the incompatible nucleotides can be 1 to 5, preferably 1 to 4, more preferably 1 to 3, even more preferably 1 to 2 and even more preferably 1. Where the primers carry at least 2 incompatible nucleotides, the Incompatible nucleotides can be located continuously or intermittently.
[000124] According to a preferred embodiment, where the mold-dependent nucleic acid polymerase having 3 'to 5' exonuclease activity is used, the TSG primer has at least one incompatible nucleotide having a structure resistant to 3 'activity for 5 'of template-dependent nucleic acid nuclease polymerases at their 3' end portion.
[000125] According to a preferred embodiment, where the mold-dependent nucleic acid polymerase having 3 'to 5' exonuclease activity is used, the TGS primer comprises at its 3 'end a single combination determinant nucleotide having a structure resistant to 3 'to 5' activity of nucleic acid nuclease of mold-dependent polymerases.
[000126] The single compatible determining nucleotide at the 3 'end of the TSG primer forms a base pair only when it is hybridized to a compatible nucleotide present on the opposite strand. However, the single compatible determining nucleotide of the TSG primer cannot form the base pair when a nucleotide present on the opposite strand is not complementary to the single compatible determining nucleotide.
[000127] In the present invention, because the single compatible determining nucleotide at the 3 'end of the TSG primer contains a structure resistant to 3' to 5 'nuclease activity, a cleavage reaction is not induced even when the 3' end of the primer of TSG is not base paired, thereby not inducing any extension reactions.
[000128] The extension of the TSG primer gives rise to the highest stable hybridization with compared target sequences without expanded TSG primer. Therefore, with the adjustment of temperatures, the presence of the expanded product (ie, target sequence) can be detected by analyzing changes in signals.
[000129] Preferably, the present invention is used for the detection of nucleotide variations. Most preferably, the nucleotide variation detected in this invention is a base substitution, even more preferably, SNP (single nucleotide polymorphism) and point mutation.
[000130] According to a preferred embodiment, the nucleotide variations can be positioned in front of the single compatible determinant nucleotide at the 3 'end of the TSG primer.
The skeleton resistant to the 3 'to 5' activity of nuclease includes any of those known to one skilled in the art. For example, it includes several phosphorothioate bonds, phosphonate bonds, phosphoramidate bonds and 2'-carbohydrate modifications. In a more preferred embodiment, nucleotides having a 3 'to 5' nuclease-resistant structure include phosphorothioate bond, alkylphosphotriester bond, arylphosphotriester bond, alkylphosphonate bond, arylphosphonate bond, hydrogen phosphonate bond, alkylphosphoramide phosphate, arylphosphoramide bond, arylphosphoramide bond, arylphosphorate bond, aryl bond phosphoroselenate bond, 2'-O-aminopropyl modification, 2'-O-alkyl modification, 2'-O-allyl modification, 2'-O-butyl modification, α-anomeric oligodeoxynucleotide modification and 1- (4'-thio-β -D-ribofuranosyl).
[000132] According to a preferred embodiment, the mold-dependent nucleic acid polymerase with exonuclease activity 3 'to 5' is a thermostable DNA polymerase that can be obtained from a variety of bacterial species, including Thermococcus lithoralis, Thermococcus barossi, Thermococcus gorgonarius, Thermotoga maritima, Thermotoga neapolitana, Thermosipho africanus, Pyrococcus furiosus (Pfu), Pyrococcus woesei, Pyrococcus horikoshii, Pyrococcus abyssi, Pyrodictium occultum, Aquifexus and Aquifexy aquife Even more preferably, the template-dependent nucleic acid polymerase having 3 'to 5' nuclease activity is Pfu DNA polymerase.
[000133] According to a preferred embodiment, the present invention further comprises the repetition of steps (a) - (b) or (a) - (c) with denaturation between repetition cycles at least twice to amplify the signal indicative of presence of the target nucleic acid sequence. The number of repetition cycles is not particularly limited, typically at least two, preferably at least five, more preferably at least ten. Denaturation should provide double-stranded duplexes formed in step (a) in single-stranded nucleic acids. Denaturation methods include, but are not limited to, heating, alkali, formamide, urea and glycoxal treatment, enzymatic methods (eg helicase action) and binding proteins. For example, denaturation can be achieved by heating at a temperature ranging from 80 ° C to 105 ° C. General methods for carrying out this treatment are provided by Joseph Sambro-ok, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (2001).
[000134] Finally, the signal indicating the presence of the target nucleic acid sequence is detected. Signal detection can be performed for each repetition cycle (ie, real time manner), at the end of the repetition (ie, end point manner) or at each of the predetermined time intervals during the repetition. Preferably, signal detection can be performed for each repetition cycle to improve detection accuracy.
[000135] The signal can be detected or measured by conventional methods of each marker. For example, the fluorescence signal can be detected or measured by conventional methods, for example, fluorometers.
[000136] The advantages of the present invention are evident in the signal detection step. Where signal detection is performed under high stringent conditions, such as high temperatures (for example, 50-85oC), false positive signals due to the hybridization of the TSG primer with non-target nucleic acid sequences can be completely eliminated.
[000137] According to a preferred embodiment, signal detection is performed by measuring or analyzing the signal modification of the reporter molecule of the marker system composed of reporter and inhibitor molecules.
[000138] According to a preferred modality, where the inhibitory molecule is fluorescent, signal detection is performed by measuring the signal modification of the inhibitory molecule or desinal modifications of both the inhibitory molecule and the reporter molecule.
[000139] According to a preferred embodiment, the inhibitor molecule is fluorescent and the signal indicating the presence of the target nucleic acid sequence to be detected is a signal from the fluorescent fluorescent inhibitor molecule.
[000140] One of the prominent attributes of the present invention is to obtain signals successfully in both a liquid and a solid phase. The present invention can be carried out in two phases, that is, a liquid phase and a solid phase. I. Target detection in a liquid phase 1. Target detection using TSG primer and polymeric nucleic acid
[000141] According to the first protocol, the target nucleic acid sequence is detected using the TSG primer and the template-dependent nucleic acid polymerase (see Figs 1A and 1B).
[000142] The first protocol comprises the steps of:
[000143] (a) hybridizing the target nucleic acid sequence to the TSG primer; wherein the TSG primer comprises (i) a hybridizing nucleotide sequence complementary to the target nucleic acid sequence and (ii) a reporter molecule and a fluorescence inhibitory molecule; wherein when the TSG primer is not hybridized to the target nucleic acid sequence, the reporter molecule and the fluorescence-inhibiting molecule are three-dimensionally adjacent to each other to allow the fluorescence-inhibiting molecule to inhibit a signal from the reporter molecule; where when the TSG primer is hybridized to the target nucleic acid sequence, the reporter molecule and the fluorescence-inhibiting molecule are three-dimensionally separated to allow the fluorescence-inhibiting molecule not to inhibit the signal from the reporter molecule, whereby the signal indicative of the presence of the target nucleic acid sequence is generated and obtained;
[000144] (b) contacting the resultant of step (a) with a mold-dependent nucleic acid polymerase under primer extension conditions such that the 3 'extension reaction is induced at the 3' end of the TSG primer; and
[000145] (c) detection of the signal indicating the presence of the target nucleic acid sequence, whereby the signal indicates the presence of the target nucleic acid sequence in DNA or mixture of nucleic acids.
[000146] According to a preferred embodiment, the detection of step (c) is carried out in real time, an end point way, or a predetermined time slot way. 2. Target detection using TSG primer and polymeric nucleic acid having 5 'to 3' nuclease activity
[000147] According to the second protocol, the target nucleic acid sequence is detected using the TSG primer and the mold-dependent nucleic acid polymerase having 5 'to 3' nuclease activity.
[000148] Preferably, the second protocol comprises the steps of:
[000149] (a) hybridizing the target nucleic acid sequence to the TSG primer; wherein the TSG primer comprises (i) a hybridizing nucleotide sequence complementary to the target nucleic acid sequence and (ii) a reporter molecule and a fluorescence inhibitory molecule; wherein when the TSG primer is not hybridized to the target nucleic acid sequence, the reporter molecule and the fluorescence-inhibiting molecule are three-dimensionally adjacent to each other to allow the fluorescence-inhibiting molecule to inhibit a signal from the reporter molecule; where when the TSG primer is hybridized to the target nucleic acid sequence, the reporter molecule and the fluorescence-inhibiting molecule are three-dimensionally separated to allow the fluorescence-inhibiting molecule not to inhibit the signal from the reporter molecule, whereby the signal indicative of the presence of the target nucleic acid sequence is generated and obtained;
[000150] (b) contact of the resultant from step (a) with a mold-dependent nucleic acid polymerase that has a 5 'to 3' nuclease activity in primer extension and cleavage conditions such that the 3 'extension reaction at the 3 'end of the TSG primer and the 5' cleavage reaction at the 5 'end portion of the TSG primer are induced, whereby the reporter molecule or the fluorescence inhibiting molecule is released from the TSG primer to generate the indicative signal the presence of the target nucleic acid sequence; and
[000151] (c) detecting the signal indicating the presence of the target nucleic acid sequence, whereby the signal indicates the presence of the target nucleic acid sequence in DNA or mixture of nucleic acids.
[000152] In accordance with a preferred embodiment, the present invention further comprises the repetition of steps (a) - (b) or (a) - (c) with denaturation between repetition cycles at least twice to amplify the signal indicative of presence of the target nucleic acid sequence.
[000153] According to a preferred embodiment, the detection of step (c) is carried out in real time, an end point way, or a predetermined time slot way. 3. Target detection using TSG primer, counterpart primer and nucleic acid polymerase
[000154] The third protocol of the present invention detects the target nucleic acid sequence by the use of (i) a template-dependent polymerase nucleic acid and (ii) a primer pair composed of the TSG primer and its capable counterpart primer to amplify the target nucleic acid sequence, such that the signal indicating the presence of the target nucleic acid sequence is amplified simultaneously with the target amplification (see Figs 2A and 2B).
[000155] The counterpart initiator can be used as a TSG initiator or not.
[000156] Preferably, the third protocol detects the target nucleic acid sequence in DNA or mixture of nucleic acids by amplification reactions using the TSG primer, comprising the steps of:
[000157] (a) hybridizing the target nucleic acid sequence with a pair of primers composed of two primers as a sense primer and a antisense primer capable of amplifying the target nucleic acid sequence; wherein at least one of the two primers is the TSG primer; wherein the TSG primer comprises (i) a hybridizing nucleotide sequence complementary to the target nucleic acid sequence and (ii) a reporter molecule and a fluorescence inhibitory molecule; wherein when the TSG primer is not hybridized to the target nucleic acid sequence, the reporter molecule and the fluorescence-inhibiting molecule are three-dimensionally adjacent to each other to allow the fluorescence-inhibiting molecule to inhibit a signal from the reporter molecule; where when the TSG primer is hybridized to the target nucleic acid sequence, the reporter molecule and the fluorescence-inhibiting molecule are three-dimensionally separated to allow the fluorescence-inhibiting molecule not to inhibit the signal from the reporter molecule, whereby the signal indicative of the presence of the target nucleic acid sequence is generated and obtained;
[000158] (b) contact of the resultant from step (a) with a mold-dependent nucleic acid polymerase under primer extension conditions such that the 3 'extension reaction at the 3' ends of the two primers is induced;
[000159] (c) denaturation of the result of step (b);
[000160] (d) repeating steps (a) - (c) at least twice to amplify both the target nucleic acid sequence and the signal indicative of the presence of the target nucleic acid sequence; and
[000161] (e) detection of the signal indicating the presence of the target sequence of nucleic acids, in which the detection is carried out for each repetition cycle of step (d), at the end of the repetition of step (d) or in each one predetermined time intervals during the repetition, such that the signal indicates the presence of the target nucleic acid sequence. 4. Target detection using TSG primer, counterpart primer and polymeric nucleic acid having 5 'to 3' nuclease activity
[000162] The fourth protocol of the present invention detects the target nucleic acid sequence by the use of (i) a template-dependent nucleic acid polymerase having 5 'to 3' nuclease activity and (ii) a pair of primers composed of the TSG primer and its counterpart primer capable of amplifying the target nucleic acid sequence, such that the signal indicating the presence of the target nucleic acid sequence is amplified simultaneously with the target amplification (see Figs 3A and 3B ).
[000163] Preferably, the fourth protocol comprises the steps of:
[000164] (a) hybridizing the target nucleic acid sequence to a pair of primers composed of two primers as a sense primer and a antisense primer capable of amplifying the target nucleic acid sequence; wherein at least one of the two primers is the TSG primer; wherein the TSG primer comprises (i) a hybridizing nucleotide sequence complementary to the target nucleic acid sequence and (ii) a reporter molecule and a fluorescence inhibitory molecule; wherein when the TSG primer is not hybridized to the target nucleic acid sequence, the reporter molecule and the fluorescence-inhibiting molecule are three-dimensionally adjacent to each other to allow the fluorescence-inhibiting molecule to inhibit a signal from the reporter molecule; where when the TSG primer is hybridized to the target nucleic acid sequence, the reporter molecule and the fluorescence-inhibiting molecule are three-dimensionally separated to allow the fluorescence-inhibiting molecule not to inhibit the signal from the reporter molecule, whereby the signal indicative of the presence of the target nucleic acid sequence is generated and obtained;
[000165] (b) contact of the resultant of step (a) with a template-dependent nucleic acid polymerase in primer extension and cleavage conditions such that the 3 'extension reaction at the 3' end of the TSG primer and the 5 'cleavage reaction at the 5' end portion of the TSG primer is induced, whereby the reporter molecule or the inhibitory molecule of the TSG primer is released from the TSG primer to generate the signal indicating the presence of the target acid sequence nucleic; and
[000166] (c) denaturation of the result of step (b);
[000167] (d) repeating steps (a) - (c) at least twice to amplify both the target nucleic acid sequence and the signal indicative of the presence of the target nucleic acid sequence; and
[000168] (e) detection of the signal indicating the presence of the target sequence of nucleic acids, in which the detection is carried out for each repetition cycle of step (d), at the end of the repetition of step (d) or in each predetermined time intervals during the repetition, such that the signal indicates the presence of the target nucleic acid sequence. II. Target detection in a solid phase
[000169] The prominent advantage of the present invention is that it is effective in detecting target nucleic acid sequences even in a solid phase, such as microarray.
[000170] According to a preferred embodiment, the present invention is carried out in solid phase and the TSG primer is immobilized on the surface of a solid substrate by its 5 'end. 1. On-Chip target detection using TSG primer and nucleic acid polymerase
[000171] According to the first solid protocol, the target nucleic acid sequence is detected using the TSG primer and a solid phase template-dependent polymeric nucleic acid (see Figs 4A and 4B).
[000172] Preferably, the first solid protocol comprises the steps of:
[000173] (a) hybridizing the target nucleic acid sequence to the TSG primer; wherein the TSG primer comprises (i) a hybridizing nucleotide sequence complementary to the target nucleic acid sequence and (ii) a reporter molecule and a fluorescence inhibitory molecule; wherein the TSG primer is immobilized on the surface of a solid substrate by its 5 'end; wherein when the TSG primer is not hybridized to the target nucleic acid sequence, the reporter molecule and the fluorescence-inhibiting molecule are three-dimensionally adjacent to each other to allow the fluorescence-inhibiting molecule to inhibit a signal from the reporter molecule; wherein when the TSG primer is hybridized to the target nucleic acid sequence, the reporter molecule and the fluorescence-inhibiting molecule are three-dimensionally separated to allow the fluorescence-inhibiting molecule not to inhibit the signal from the reporter molecule, whereby the indicative signal the presence of the target nucleic acid sequence is generated and obtained;
[000174] (b) contact of the resultant from step (a) with a mold-dependent nucleic acid polymerase under primer extension conditions such that the 3 'extension reaction at the 3' end of the TSG primer is induced; and
[000175] (c) detecting the signal indicative of the presence of the target sequence of nucleic acids in the solid substrate, whereby the signal indicates the presence of the target sequence of nucleic acids in DNA or mixture of nucleic acids. 2. On-Chip target detection using TSG primer, counterpart primer and nucleic acid polymerase
[000176] The second solid protocol of the present invention detects the target nucleic acid sequence by the use of (i) a template-dependent nucleic acid polymerase and (ii) a primer pair composed of the TSG primer and its counterpart primer capable of amplify the target nucleic acid sequence, such that the signal indicating the presence of the target nucleic acid sequence is amplified simultaneously with the target amplification.
[000177] In other words, the second solid protocol runs on-chip PCR technology in real time.
[000178] Preferably, the second solid protocol comprises the steps of:
[000179] (a) hybridizing the target nucleic acid sequence to a pair of primers composed of two primers as a sense primer and a antisense primer capable of amplifying the target nucleic acid sequence; wherein at least one of the two primers is the TSG primer; wherein the TSG primer comprises (i) a hybridizing nucleotide sequence complementary to the target nucleic acid sequence and (ii) a reporter molecule and a fluorescence inhibitory molecule; wherein at least one of the two primers is immobilized on the surface of a solid substrate by its 5 'end and another primer is not immobilized; the immobilized initiator is the TSG initiator; wherein when the TSG primer is not hybridized to the target nucleic acid sequence, the reporter molecule and the fluorescence-inhibiting molecule are three-dimensionally adjacent to each other to allow the fluorescence-inhibiting molecule to inhibit a signal from the reporter molecule; wherein when the TSG primer is hybridized to the target nucleic acid sequence, the reporter molecule and the fluorescence-inhibiting molecule are three-dimensionally separated to allow the fluorescence-inhibiting molecule not to inhibit the signal from the reporter molecule, whereby the indicative signal the presence of the target nucleic acid sequence is generated and obtained;
[000180] (b) contact of the resultant from step (a) with a mold-dependent nucleic acid polymerase under primer extension conditions such that the 3 'extension reaction at the 3' ends of the two primers is induced;
[000181] (c) denaturation of the result of step (b);
[000182] (d) repeating steps (a) - (c) at least twice to amplify both the target nucleic acid sequence and the signal indicative of the presence of the target nucleic acid sequence; and
[000183] (e) detection of the signal indicating the presence of the target nucleic acid sequence, in which the detection is carried out for each repetition cycle of step (d), at the end of the repetition of step (d) or in each one predetermined time intervals during the repetition, such that the signal indicates the presence of the target nucleic acid sequence.
[000184] According to a preferred embodiment, the TSG primer is immobilized on the surface of a solid substrate by its 5 'end, and another primer is not immobilized and not a TSG primer.
[000185] According to a preferred embodiment, the TSG primer and the counterpart primer have a dual initiation oligonucleotide (DPO) structure represented by the following general formula I: 5'-Xp-Yq-Zr-3 '(I) in that Xp represents a first 5 'priming portion which has a hybridizing nucleotide sequence complementary to the target nucleic acid; Yq represents a separation portion comprising at least three universal bases, Zr represents a second 3 'initiation portion that has a hybridizing nucleotide sequence complementary to the target nucleic acid; p, q and r represent the number of nucleotides, and X, Y, and Z are deoxyribonucleotides or ribonucleotides; the Tm of the first initiation portion 5 'is higher than that of the second initiation portion 3' and the separation portion has the lowest Tm in the three portions; the separation portion separates the first 5 'initiation portion from the second 3' initiation portion in terms of annealing events to the target nucleic acid, whereby the annealing specificity of the oligonucleotide is determined doubly by the first 5 'initiation portion and the second 3 'primer portion such that the total annealing specificity of the primer is increased.
[000186] The structure of DPO as a primer version of DSO (dual specificity oligonucleotide) was first proposed by the present inventor (see WO 2006/095981; Chun et al., Dual priming oligonucleotide system for the multiplex detection of respiratory viruses and SNP genotyping of CYP2C19 gene, Nucleic Acid Research, 35: 6e40 (2007)).
[000187] DPO incorporates a new concept in which its hybridization or annealing is doubly determined by the 5 'high specificity portion of Tm (or the first 5' initiation portion) and 3 'low specificity portion of Tm (or the second initiation portion 3 ') separated by the separation portion, exhibiting dramatically increased specificity of hybridization (see WO 2006/095981; Kim et al., Direct detection of lamivudine-resistant hepatitis B virus mu tants by multiplex PCR using dual-priming oligonucleotide primers, Journal of Virological Methods, 149: 76-84 (2008); Kim, et. al., Rapid detection and identification of 12 respiratory viruses using a dual priming oligonucleotide system-based multiplex PCR assay, Journal of Virological Methods, doi : 10.1016 / j.jviromet.2008.11.007 (2008); Horii et. Al., Use of dual priming oligonucleotide system to detect multiplex sexually transmitted pathogens in clinical specimens, Letters in Applied Microbiology, doi: 10.111 / j.1472-765X200 9.02618x (2009)). As such, DPO therefore has two segments of primers with distinct hybridization properties: the first 5 'initiation portion that initiates stable hybridization, and the second 3' initiation portion that primarily determines the target specificity.
[000188] Amplification (particularly, multiplex amplification) using primers having the DPO structure in the present invention ensures to obtain amplicons without false positive and negative data.
[000189] According to a preferred embodiment, the universal base in the separation portion is selected from the group consisting of deoxy-inosine, inosine, 7-deaza-2'-deoxy-inosine, 2-aza-2'-deoxy -inosine, 2'-OMe inosine, 2'-F inosine, deoxy 3-nitropyrrole, 3-nitropyrrole, 2'-OMe 3-nitropyrrole, 2'-F 3-nitropyrrole, 1- (2'-deoxy-beta- D- ribofuranosyl) -3-nitropyrrole, deoxy 5-nitroindole, 5-nitroindole, 2'-OMe 5-nitroindole, 2'-F 5-nitroindole, deoxy 4-nitrobenzimidazole, 4-nitrobenzimidazole, 4-aminobenzimidazole, 4- aminobenzimidazole, deoxy nebularin, 2'-F nebularin, 2'-F 4-nitrobenzimidazole, PNA-5- introindol, PNA-nebularin, PNA-inosine, PNA-4-nitrobenzimidazole, PNA-3-nitropyrrole, morpholino-5-nitroindol , morpholino-nebularin, morpholino-inosine, morpholino-4-nitrobenzimidazole, morpholino-3-nitropyrrole, phosphoramidate-5-nitroindole, phosphoramidate-nebularine, phosphoramidate-inosine, phosphoramidate-4-nitrobenzimidazole-3-phosphoramide , 2'-0- methoxyethyl inosine, 2 ’0-methoxyethyl nebularin, 2’-0-methoxyethyl 5-nitroindole, 2’-0-methoxyethyl 4-nitro-benzimidazole, 2’-0-methoxyethyl 3-nitropyrrole and combinations thereof. More preferably, the universal base is deoxy-inosine, 1- (2'-deoxy-beta-D-ribofuranosyl) -3-nitropyrrole or 5-nitroindole, even more preferably, deoxy-inosine.
[000190] Preferably, the separation portion comprises contiguous nucleotides having at least three, more preferably at least four, even more preferably at least five universal bases.
[000191] Preferably, in the DPO structure the first 5 'initiation portion is longer than the second 3' initiation portion. The first 5 'initiation portion is preferably 15 to 60 nucleotides, more preferably 15 to 40 nucleotides, even more preferably 15 to 25 nucleotides in length. It is preferred that the second initiation portion 3 'has 3 to 15 nucleotides, more preferably 5 to 15 nucleotides, even more preferably 6 to 13 nucleotides in length. The separation portion is preferably 3 to 10 nucleotides, more preferably 4 to 8 nucleotides, even more preferably 5 to 7 nucleotides in length. According to a preferred embodiment, the Tm of the first 5 'initiation portion ranges from 40 ° C to 80 ° C, more preferably 45 ° C to 65 ° C. The Tm of the second initiation portion 3 'preferably ranges from 10 ° C to 40 ° C. It is preferred that the Tm of the separation portion varies from 3 ° C to 15 ° C.
[000192] According to a preferred embodiment, the Tm of the first initiation portion 3 'varies from 40 ° C to 80 ° C, more preferably 45 ° C to 65 ° C. The Tm of the second 5 'initiation portion preferably ranges from 10 ° C to 40 ° C. It is preferred that the Tm of the separation portion varies from 3 ° C to 15 ° C.
[000193] According to a preferred embodiment, all two primers used in the amplification of the present invention have the DPO structure.
[000194] Conventional technologies using primers to detect target nucleic acid cannot be free of false signals at a satisfactory level due to inherent limitations of the primers and probes used. However, primers having the DPO structure with such a deliberative design are hybridized to the target nucleic acid sequence with dramatically increased specificity, allowing to detect the target nucleic acid sequence without false signals.
[000195] As used in this application, the term "conventional" in conjunction with primers means any primer that does not have the DPO structure. They are described in this application as conventional primers.
[000196] According to a preferred embodiment, one of the reporter molecule and the inhibitor molecule is positioned on the first 5 'initiation portion and the other on the first 5' initiation portion, second 3 'initiation portion or separation portion.
[000197] The present invention does not require that any particular sequence or length of the target nucleic acid sequences be detected and / or amplified.
[000198] Where an mRNA is used as starting material, a reverse transcription step is required before performing the annealing step, details of which are found in Joseph Sambrok, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2001); and Noonan, K. F. et al., Nucleic Acids Res. 16: 10366 (1988)). For reverse transcription, a random hexamer or a mRNA hybridizable dT oligonucleotide primer can be used.
[000199] The dT oligonucleotide primer is comprised of dTMPs, one or more of which can be replaced by other dNMPs as long as the dT primer can serve as a primer. Reverse transcription can be done with reverse transcriptase which has RNase H activity. If one uses an enzyme having RNase H activity, it may be possible to skip a separate digestion step with RNase H by carefully choosing the reaction conditions.
[000200] In particular, target nucleic acid sequences that can be detected and / or amplified include any of prokaryotic, eukaryotic nucleic acid (e.g., protozoa and parasites, fungi, yeast, higher, lower plants and higher animals, including mammals and human) or naturally occurring viral (for example, Herpes virus, HIV, influenza virus, Epstein-Barr virus, hepatitis virus, polio virus, etc.) or viroid.
[000201] The advantages of the present invention can be highlighted in simultaneous (multiple) detection of at least two target nucleic acid sequences.
[000202] According to a preferred embodiment, the target nucleic acid sequence comprises at least two types (more preferably, at least three types, even more preferably at least five types) of nucleic acid sequences and the TSG primers comprise at least two types (more preferably, at least three types, even more preferably at least five types) of primers. According to a preferred embodiment, the counterpart primer capable of amplifying the target nucleic acid sequence together with the TSG primer comprises at least two types (more preferably, at least three types, even more preferably at least five types) of initiators.
[000203] For example, where the present invention is carried out using a reaction vessel containing five TSG primers (each having a fluorescent reporter molecule with a different emission wavelength), five counterpart primers and a sample of nucleic acids , generates five different fluorescence signals corresponding to five different target nucleic acids, allowing the simultaneous detection of five different target nucleic acid sequences in real time. In this case, all of the fluorescence-inhibiting molecules used can be selected to have different properties from one another. Alternatively, all or some of the fluorescence inhibiting molecules used can be selected to have the same properties.
[000204] Furthermore, the present invention is very useful in detecting a variation of nucleotides. The term "nucleotide variation" used in this application refers to a nucleotide polymorphism in a DNA sequence at a particular position between contiguous DNA segments that are otherwise similar in sequence. Such contiguous DNA segments include a gene or any other portion of a chromosome. For example, the nucleotide variation detected in the present invention includes SNP (single nucleotide polymorphism), deletion, insertion, substitution and translocation. The exemplified nucleotide variation includes numerous variations in a human genome (for example, variations in the MTHFR (methylenetetrahydrofolate reductase) gene), variations involved in drug resistance of pathogens, and variations cause tumorigenesis.
[000205] According to a preferred embodiment, the target nucleic acid sequence used in the present invention is a pre-amplified nucleic acid sequence. The use of the pre-amplified nucleic acid sequence allows to significantly increase the sensitivity and specificity of the target detection of the present invention. The target nucleotide sequence in a smaller amount is pre-amplified to give an adequate amount and then detected by the present method, increasing the sensitivity and specificity of the target detection of the present invention. Interestingly, where the TSG primer to be hybridized to a sequence downstream of primers used in pre-amplification is used in the present method, it serves as a nested primer to increase the specificity of the target detection of the present invention.
[000206] According to a preferred embodiment, where the pre-amplified nucleic acid sequence is used in the present invention to detect the target nucleic acid sequences by the amplification reaction, the primer pair used in the present invention is a primer pair of a nested amplification.
[000207] In another aspect of this invention, a kit is provided to detect a target nucleic acid sequence from a DNA or a mixture of nucleic acids using a target signal generation primer (TSG primer), which comprises:
[000208] (a) the TSG primer comprising (i) a hybridizing nucleotide sequence complementary to the target nucleic acid sequence and (ii) a reporter molecule and a fluorescence inhibitory molecule; wherein when the TSG primer is not hybridized to the target nucleic acid sequence, the reporter molecule and the fluorescence-inhibiting molecule are three-dimensionally adjacent to each other to allow the fluorescence-inhibiting molecule to inhibit a signal from the reporter molecule; wherein when the TSG primer is hybridized to the target nucleic acid sequence, the reporter molecule and the fluorescence-inhibiting molecule are three-dimensionally separated to allow the fluorescence-inhibiting molecule not to inhibit the signal from the reporter molecule, whereby the indicative signal the presence of the target nucleic acid sequence is generated and obtained; and
[000209] (b) a template-dependent nucleic acid polymerase capable of inducing the 3 'extension reaction at the 3' end of the TSG primer acting on a hybridization result between the TSG primer and the target nucleic acid sequence .
[000210] Since the kit of this invention is built to carry out the detection method of the present invention described above, the common descriptions among them are omitted in order to avoid the excessive redundancy that leads to the complexity of this specification.
[000211] The present kits can optionally include the reagents necessary to perform target amplification PCR reactions (e.g., PCR reactions), such as buffers, DNA polymerase cofactors, and deoxyribonucleotide-5-triphosphates. Optionally, the kits can also include multiple polynucleotide molecules, reverse transcriptase, various buffers and reagents, and antibodies that inhibit DNA polymerase activity.
[000212] Kits can also include reagents needed to perform positive and negative control reactions. The optimum amounts of reagents to be used in a given reaction can be readily determined by the verse who has the benefit of the current disclosure. Kits are typically adopted to contain constituents previously described in separate packaging or compartments.
[000213] The attributes and advantages of the present invention will be summarized as follows:
[000214] (a) The present invention is designed for a new method of real-time PCR to detect a target nucleic acid sequence. The TSG primer is capable of generating signals indicative of the presence of the target nucleic acid sequence of the dual interactive marker system and amplifying the target nucleic acid sequence by its 3 'extension reaction during the PCR reaction. Consequently, it can be appreciated that the present invention can provide a new method for detecting target nucleic acid sequences simultaneously with the target amplification in real-time PCR.
[000215] (b) The TSG primer extension reaction allows incorporating the dual labeled TSG primer into the expanded product, thereby generating the signal intensity in parallel with the quantity of the amplified product. Such a coupling strategy adopted for the present invention ensures more accurate quantitative analysis of the target nucleic acid sequences.
[000216] (c) Probably unlabeled probes, where the TSG primer per se, are not specifically hybridized to non-target sequences without any primer extension, false-positive signals cannot be generated by performing signal detection under high stringent conditions, such as high temperature.
[000217] (d) The signal generation in the present invention can be performed only by hybridization with the target nucleic acid sequences without cleavage reactions by nuclease activities. In this connection, the present invention does not necessarily require that the nucleic acid polymerases should have 5 'to 3' nuclease activity or 3 'to 5' nuclease activity and thus allow the use of a wide variety of nucleic acid polymerases for various applications.
[000218] (e) Where the use of nucleic acid polymerases having 5 'to 3' nuclease activity, the present invention can obtain signals from the 5 'cleavage reaction of the TSG primer hybridized to the target nucleic acid sequences, increasing efficiency target detection.
[000219] (f) Conventional real-time PCR methods require more complicated labeled probes or modified primer structure, such as a clamp structure, which makes the design, synthesis or sequence selection of the probe and primer difficult. However, since the TSG primer of the present invention is used for not only target amplification but also signal amplification without additional labeled probes or more complicated modified primer structure, its design, synthesis and sequence selection for time PCR real are very simple and easy. Therefore, the present invention provides a new method of real-time PCR that can be performed much more adequately than conventional real-time PCR technologies.
[000220] (g) The optimization of real-time PCR methods based on conventional probes is difficult because it is necessary that the hybridization conditions must be optimized for probes as well as primers. It is assumed that conventional methods of real-time PCR using primers with tails to form clamp loops to optimize reaction conditions with consideration of formation and deformation of clamp loops in primers. On the contrary, the present invention can be completely free of the uncomfortable materials and failures associated with the optimization of such conventional methods of real-time PCR because its optimization can be done with consideration only to initiators without any structural modification.
[000221] (h) Conventional real-time PCR methods are unlikely to adopt a multiplex assay due to difficulties in the design and optimization of the primer or probe. In contrast, since the present invention uses only a labeled primer without additional probes or modified primer structure more complicated in real-time PCR, it is possible to display excellent target detection in real time in a multiplex manner.
[000222] (i) Compared to conventional real-time PCR probes, the TSG primer is expanded during the process and the expanded TSG primer shows higher binding strength for target nucleic acid sequences. Conventional real-time PCR primers require a more complicated modified structure, such as a loop clip that impairs binding to the target nucleic acid sequence. In contrast, the TSG primer does not require such modifications in order for the TSG primer to have the best binding efficiency for target nucleic acid sequences. This attribute is responsible in part for increasing the target detection efficiency of the present method.
[000223] (j) The present method can readily perform a real-time PCR reaction by simply marking the primers that are designed to be used for conventional PCR reactions and applying the primers marked as TSG primers to the PCR reaction in time real. In summary, primers for generating amplicons in conventional PCR reactions are easily labeled with suitable markers and then used to detect the target nucleic acid sequences in the present invention by real-time PCR reactions. In this sense, it is considered that the present method is more effective in time and cost in the development of a real-time PCR assay.
[000224] (k) As discussed further above, the primers used in the present invention having the DPO structure give rise to an improvement in their binding specificity, thereby eliminating false-positive signals associated with the non-target binding of primers in reactions of Real-time PCR.
[000225] The present invention will now be described in further detail by way of examples. It would be obvious to those skilled in the art that these examples are intended to be more concretely illustrative and the scope of the present invention as presented in the added claims is not limited to or by the examples. EXAMPLES EXAMPLE 1: Evaluation of the TSG primer with DNA polymerase that has no 5 'to 3' exonuclease activity in the detection of target nucleic acid sequences
[000226] The TSG primer of this invention has been assessed whether the TSG primer can generate a signal sufficient to detect a target nucleic acid sequence only by its target hybridization and extent in which a template-dependent nucleic acid polymerase is not active. 5 'to 3' of exonuclease is used.
[000227] To test this assessment, we use the Streptococcus pneumoniae gene or Staphylococcus aureus gene as target templates. For experimental convenience, synthetic oligonucleotides were used as templates for the S. pneumoniae gene and the S. aureus gene. The Stoffel Fragment without intrinsic 5 'to 3' exonuclease activity was used as DNA polymerase. Two TSG primers that have different distances between a reporter molecule and a fluorescence inhibiting molecule were examined on each target, respectively. 6-FAM (6-carboxyfluorescein) was used as a fluorescent reporter molecule and located at the 5 'end of TSG primers. The Black Hole 1 inhibitor (BHQ-1) was used as an inhibitor molecule. The nucleic acid synthesis reaction was carried out without repeated denaturation, hybridization and primer extension. The signals were measured at a predetermined time interval. A. Nucleic acid synthesis reaction for the detection of the S. pneumoniae gene
[000228] When the target nucleic acid sequence of the S. pneumoniae gene is used as a template, the synthetic template sequences and TSG primers used in this Example are: SP_T105 5'- TTACTGAAAGACAATGAAGACAACCTAACAGGGGAAGATGTT- CGCG AAGGCTTAACTGCACTACTA '(SEQ ID NO: 1) SP_TSG (9) 5' - [6-FAM] TCCTTCAAAC [T (BHQ-1)] GTGGATTTGGGTGT-3 '(SEQ ID NO: 2) SP_TSG (21) 5' - [6- FAM] TCCTTCAAACTGTGGATTTGGG [T (BHQ-1)] GT-3 '(SEQ ID NO: 3) (The number 9 or 21 in parentheses means the nucleotide distance between a reporter molecule and a fluorescence-inhibiting molecule)
[000229] The nucleic acid synthesis reaction with the TSG primer was conducted in the final volume of 20 μl containing 2 pmols of the template (SEQ ID NO: 1), 2 μl of 10X Stoffel buffer [containing 100 mM Tris-HCl (pH 8.3) and 100 mM KCl], 1 unit of AmpliTaq® DNA polymerase, Stoffel Fragment (Applied BioSystems, USA), 200 μM each of the four dNTPs (dATP, dCTP, dGTP and dTTP), 5 mM MgCl2 and 5 pmols of the TSG primer (SEQ ID NO: 2 or 3); the tube containing the reaction mixture was placed in the thermocycler in real time (CFX96, Bio-Rad); the reaction mixture was denatured for 2 min at 95 ° C and subjected to incubation for 40 min at 50 ° C. The detection of the generated signal was carried out in the interval of 1 min.
[000230] As shown in FIG. 5, each of the two TSG primers showed much higher fluorescent intensity in the presence of the mold (Nos. 1 and 3) than that in the absence of the mold (Nos. 2 and 4). Therefore, it can be understood that the TSG primers can provide sufficient signals to detect the S. pneumoniae gene by hybridizing and extending the TSG primers during the nucleic acid synthesis reaction.
[000231] It is notable that the TSG primer (SEQ ID NO: 3) which has a 21 nucleotide reporter molecule away from an inhibitor molecule showed more distinct modifications of the signal strength (ie, modification in RFU values) in the presence and absence of the template than the TSG primer (SEQ ID NO: 2) which has a 9 nucleotide reporter molecule away from an inhibitor molecule. B. Nucleic acid synthesis reaction for the detection of the S. aureus gene
[000232] When the target nucleic acid sequence of S. aureus gene is used as a template, the sequences of the synthetic template and the primers TSG used in this Example are SA_T200 5'-GAT GCCAATAAAACTAGGAGGAAATTTAAATGTTAGAATTTGAACAAG- TTAATCATTTAGCGACTTTAAAGGTCATTGGTGTAGGTGGTGG- CGGTAACAACGCCGTAAACCGAATGATTGACCACGGAATGAATAA- TGTTGAATTTATCGCTATCAACACAGACGGTCAAGCTTTAAACTTA - TCTAAAGCTGAATCTAAA-3 '(SEQ ID NO: 4) SA_TSG (6) 5' - [6-FAM] CATTCCG [T (BHQ-1)] GGTCAATCATTCGGTT-3 '(SEQ ID NO: 5) SA_TSG (21) 5' - [6-FAM] CATTCCGTGGTCAATCATTCGG [T (BHQ-1)] T- 3 '(SEQ ID NO: 6) (The number 6 or 21 in parentheses means the nucleotide distance between a reporter molecule and an inhibitor molecule fluorescence)
[000233] The nucleic acid synthesis reaction was conducted as the protocol used for S. pneumoniae, except for the template (0.2 pmols of S. aureus) and TSG primers (SEQ ID NO: 5 or 6).
[000234] As shown in FIG. 6, each of the two TSG primers showed much higher fluorescent intensity in the presence of the mold (Nos. 1 and 3) than that in the absence of the mold (Nos. 2 and 4). Therefore, it can be appreciated that TSG primers can provide sufficient signals to detect the S. aureus gene by hybridizing and extending TSG primers during the nucleic acid synthesis reaction.
[000235] It is notable that the TSG primer (SEQ ID NO: 6) which has a 21 nucleotide reporter molecule away from an inhibitor molecule showed more distinct changes in signal intensity (ie, change in RFU values ) in the presence and absence of the template than the TSG primer (SEQ ID NO: 5) which has a 6 nucleotide reporter molecule spaced from an inhibitor molecule. EXAMPLE 2: Examination of the TSG primer with DNA polymerase that has no 5 'to 3' exonuclease activity under real-time PCR reaction conditions for the detection of a target nucleic acid
[000236] We are still examining whether the TSG primer can generate enough signal to detect a target nucleic acid sequence during the real-time PCR reaction using a template-dependent nucleic acid polymerase with no 5 'to 3' exonuclease activity.
[000237] To examine this assessment, real-time PCR reactions for the detection of S. pneumoniae, S. aureus, Neisseria gonorrhoeae and Neisseria meningitidis genes were conducted respectively using pairs of primers including TSG primers. Stoffel fragment without intrinsic 5 'to 3' exonuclease activity was used as a DNA polymerase. Two TSG primers having different distances between a reporter molecule and a fluorescence-inhibiting molecule were examined on each target gene. A. Real-time PCR for the detection of the S. pneumoniae gene
[000238] When the target nucleic acid sequence of the S. pneumoniae gene is used as a template, the sequences of a sense primer and TSG primers (such as antisense primers) used in this Example are: SP_F1 5 ' -GGTTTCCGTACAGCCTTGAIIIIIGTTATCAATG-3 '(SEQ ID NO: 7) SP_TSG (9) 5' - [6-FAM] TCCTTCAAAC [T (BHQ- 1)] GTGGATTTGGGTGT-3 '(SEQ ID NO: 2) SP_TSG (21)' - [6-FAM] TCCTTCAAACTGTGGATTTGGG [T (BHQ-1)] GT-3 '(SEQ ID NO: 3) (I stands for deoxy-inosine and the number 9 or 21 in parentheses means the distance of nucleotides between a reporter molecule and a fluorescence-inhibiting molecule)
[000239] The real-time PCR reaction for the detection of S. pneumoniae was conducted in the final volume of 20 μl containing 10 ng of S. pneumoniae genomic DNA, 2 μl of 10X Stoffel buffer containing 100 mM Tris-HCl ( pH 8.3) and 100 mM KCl, 1 unit of Ampli- Taq® DNA polymerase, Stoffel Fragment (Applied BioSystems, USA), 200 μM each of the four dNTPs (dATP, dCTP, dGTP and dTTP), 5 mM of MgCl2, 5 pmols of the sense primer (SEQ ID NO: 7) and 5 pmols of the TSG primer (SEQ ID NO: 2 or 3) as a antisense primer; the tube containing the reaction mixture was placed in the thermocycler in real time (CFX96, Bio-Rad); the reaction mixture was denatured for 2 min at 95 ° C and subjected to 30 cycles of 30 s at 94 ° C, 60 s at 55 ° C and 10 s at 72 ° C. The detection of the generated signal was carried out in the annealing step (55 ° C) of each cycle.
[000240] As shown in Fig. 7, fluorescent signals from S. pneumoniae were observed in the presence of S. pneumoniae template (Nos. 1 and 3) in the real-time PCR reaction using TSG primers and a dependent DNA polymerase of mold that has no 5 'to 3' nuclease activity, whereas there was no fluorescent signal in the negative controls without the target mold (Nos. 2 and 4).
[000241] The TSG primer (SEQ ID NO: 3) which has a 21 nucleotide reporter molecule away from an inhibitor molecule showed lower Ct values and higher RFU values than the TSG primer (SEQ ID NO: 2 ) which has a reporter 9 nucleotide molecule away from an inhibitor molecule. B. Real-time PCR for the detection of the S. aureus gene
[000242] When the target nucleic acid sequence of S. aureus is used as a template, the sequences of a sense primer and TSG primers (such as antisense primers) used in this Example are: SA_F1 5'-TGTTAGAATTTGAACAAGGATTTAAIIIIITAGCGACTTT -3 '(SEQ ID NO: 8) SA_TSG (6) 5' - [6-FAM] CATTCCG [T (BHQ-1)] GGTCAATCATTCGGTT-3 '(SEQ ID NO: 5) SA_TSG (21) 5' - [ 6-FAM] CATTCCGTGGTCAATCATTCGG [T (BHQ-1)] T-3 '(SEQ ID NO: 6) (I stands for deoxy-inosine and the number 6 or 21 in parentheses means the distance between nucleotides between a reporter molecule and a molecule fluorescence inhibitor)
[000243] The real-time PCR reaction was conducted as the protocol used for the detection of S. pneumoniae, except for the template (S. aureus), sense sense primer (SEQ ID NO: 8) and TSG primers (SEQ ID NO: 5 or 6) as antisense primers.
[000244] As shown in Fig. 8, fluorescent signals from S. aureus were observed in the presence of the S. aureus template (Nos. 1 and 3) in the real-time PCR reaction using TSG primers and a dependent DNA polymerase of mold that has no 5 'to 3' nuclease activity, whereas there was no fluorescent signal in the negative controls without the target mold (Nos. 2 and 4)
[000245] The TSG primer (SEQ ID NO: 6) which has a 21 nucleotide reporter molecule away from an inhibitor molecule showed lower Ct values and higher RFU values than the TSG primer (SEQ ID NO: 5 ) which has a 6 nucleotide reporter molecule away from an inhibitor molecule. C. Real-time PCR for detection of the N. gonorrhoeae gene When the target nucleic acid sequence of N. gonorrhoeae is used as a template, the sequences of a sense primer and TSG primers (as sense primers reverse) used in this Example are: NG_F1 5'-TACGCCTGCTACTTTCACGCTIIIIIGTAATCAGAT-3 '(SEQ ID NO: 9) NG_TSG (4) 5' - [6-FAM] CTCAT [T (BHQ- 1)] GGCGTGTTTCGCATATTTAAG-3 '(SEQ NO: 10) NG_TSG (22) 5 '- [6-FAM] CTCATTGGCGTGTTTCGCATATT [T (BHQ- 1)] AAG-3' (SEQ ID NO: 11) (I represents deoxy-inosine and the number 4 or 22 in parentheses means the distance of nucleotides between a reporter molecule and a fluorescence-inhibiting molecule)
[000246] The real-time PCR reaction was conducted as the protocol used for detection of S. pneumoniae, except for the template (N. gonorrhoeae), a forward sense primer (SEQ ID NO: 9) and TSG primers ( SEQ ID NO: 10 or 11) as antisense primers.
[000247] As shown in FIG 9, the fluorescent signals from N. gororhoeae were observed in the presence of the N. gonorhoeae template (Nos. 1 and 3) in the real-time PCR reaction using TSG primers and a Mold-dependent DNA polymerase that has no 5 'to 3' nuclease activity, whereas there was no fluorescent signal in the negative controls without the target template (Nos. 2 and 4) [000248] In addition, the TSG primer (SEQ ID NO: 11) which has a 22 nucleotide reporter molecule away from an inhibitory molecule showed lower Ct values and higher RFU values than the TSG primer (SEQ ID NO: 10) which has a reporter molecule 4 nucleotides away from an inhibitory molecule, as shown in FIG 9.
[000248] In addition, the TSG primer (SEQ ID NO: 11) which has a 22 nucleotide reporter molecule away from an inhibitor molecule showed lower Ct values and higher RFU values than the TSG primer (SEQ ID NO: 10) which has a reporter molecule 4 nucleotides away from an inhibitory molecule, as shown in FIG 9. D. Real-time PCR for the detection of the N. meningitidis gene
[000249] When the target nucleic acid sequence of N. menin gitidis is used as a template, the sequences of a antisense primer and TSG primers (such as sense primers) used in this Example are: NM_R1 5'- CCATAACCTTGAGCAATCCAIIIIICCTGACGTTC-3 '(SEQ ID NO: 12) NM_TSG (7) 5' - [6-FAM] CTTATCGC [T (BHQ-1)] TTCTGAAGCCATTG-3 '(SEQ ID NO: 13) NM_TSG (20) 5'- [6-FAM] CTTATCGCTTTCTGAAGCCAT [T (BHQ-1)] G-3 '(SEQ ID NO: 14) (I stands for deoxy-inosine and the number 7 or 20 in parentheses means the distance of nucleotides between a reporter molecule and a fluorescence inhibitory molecule)
[000250] The real-time PCR reaction was conducted as the protocol used for the detection of S. pneumoniae, except for the template (N. meningitidis), a reversed primer (SEQ ID NO: 12) and TSG primers ( SEQ ID NO: 13 or 14) as forward sense initiators.
[000251] As shown in FIG 10, fluorescent signals from N. meningitidis were observed in the presence of the N. meningitidis template (Nos. 1 and 3) in the real-time PCR reaction using TSG primers and a DNA polymerase dependent template that has no 5 'to 3' nuclease activity, whereas there was no fluorescent signal in the negative controls without the target template (Nos. 2 and 4) [000252] In addition, the TSG primer (SEQ ID NO: 14 ) that has a 20 nucleotide reporter molecule away from an inhibitor molecule showed lower Ct values and higher RFU values than the TSG primer (SEQ ID NO: 13) that has a 7 nucleotide reporter molecule away from a inhibitory molecule, as shown in FIG 10.
[000252] In addition, the TSG primer (SEQ ID NO: 14) which has a 20 nucleotide reporter molecule away from an inhibitor molecule showed lower Ct values and higher RFU values than the TSG primer (SEQ ID NO: 13) which has a 7 nucleotide reporter molecule away from an inhibitory molecule, as shown in FIG 10. EXAMPLE 3: Real-time PCR sensitivity using the TSG and DNA polymerase initiator that has no 5 'to 3' exonuclease activity for the detection of S. aureus
[000253] The sensitivity of real-time PCR using the TSG primer and DNA polymerase that has no 5 'to 3' exonuclease activity was tested by detecting the target nucleic acid sequences of the S. aureus gene. For this study, the TSG primer (SEQ ID NO: 6) as a antisense primer was used in the real-time PCR reaction. Genomic DNA serially diluted (10-fold dilution) from 100 pg to 10 fg S. aureus was used as a template.
[000254] The strings of a sense primer and the TSG primer (as a sense antenna) used in this Example are: SA_F1 5'-TGTTAGAATTTGAACAAGGATTTAAIIIIITAGCGACTTT-3 '(SEQ ID NO: 8) SA_TSG (21) 5' - [6-FAM] CATTCCGTGGTCAATCATTCGG [T (BHQ-1)] T-3 '(SEQ ID NO: 6) (I stands for deoxy-inosine and the number 21 in parentheses means the distance between nucleotides between a reporter molecule and a molecule fluorescence inhibitor)
[000255] The real-time PCR reaction was conducted in the final 20 μl volume containing diluted genomic DNA (from 100 pg to 10 fg; 10-fold dilution) of S. aureus, 2 μl of 10X Stoffel buffer containing Tris- 100 mM HCl (pH 8.3) and 100 mM KCl, 1 unit of AmpliTaq® DNA polymerase, Stoffel Fragment (Applied BioSystems, USA), 200 μM each of the four dNTPs (dATP, dCTP, dGTP and dTTP), 5 mM MgCl2, 5 pmols of sense primer (SEQ ID NO: 8) and 5 pmols of TSG primer (SEQ ID NO: 6) as a antisense primer; the tube containing the reaction mixture was placed in the thermocycler in real time (CFX96, Bio-Rad); the reaction mixture was denatured for 2 min at 95 ° C and subjected to 40 cycles of 30 s at 94 ° C, 60 s at 55 ° C and 10 s at 72 ° C. The detection of the generated signal was performed in the annealing step (55 ° C) of each cycle.
[000256] As shown in FIG. 11, when real-time PCR was performed using the serial dilution of genomic DNA from S. aureus as described in Fig. 11, it can detect the target nucleic acid sequence up to 100 fg (Numbers 1-4). EXAMPLE 4: Signal generation by 5 'cleavage reaction at the 5' end portion of the TSG primer by mold-dependent polymerase nucleic acid having 5 'to 3' exo-nuclase activity
[000257] We found that the labeled primers hybridized to the target nucleic acid sequences undergoing a 5 'cleavage reaction at their 5' end portion by the 5 'to 3' nuclease activity of a template-dependent polymeric nucleic acid and reaction of 5 'cleavage intricately adopts the detection of target nucleic acid sequences generating signals from target sequences (see PCT / KR2009 / 007064).
[000258] Therefore, we examine whether the signals are generated by a 5 'cleavage reaction at the 5' end portion of the TSG primer by the mold-dependent nucleic acid polymerase having the 5 'to 3' exonuclase activity.
[000259] To test this evaluation, we used S. pneumoniae as a target template and for experimental convenience, the synthetic oligonucleotide was used as a template for the S. pneumoniae gene. Two TSG primers having different distances between a reporter molecule and a fluorescence inhibiting molecule were examined, respectively. 6-FAM (6-carboxyfluorescein) was used as a fluorescent reporter molecule and located at the 5 'end of TSG primers. The Black Hole 1 inhibitor (BHQ-1) was used as an inhibitor molecule. The nucleic acid synthesis reaction was carried out with repeated denaturation, hybridization and primer extension. The signal was measured at the hybridization stage of each repetition. The Stoffel fragment without intrinsic 5 'to 3' exonuclease activity and Taq DNA polymerase having 5 'to 3' exonuclease activity was used as DNA polymerases.
[000260] The sequences of the synthetic template and TSG primers used in this Example are: SP_T105 5'- TTACTGAAAGACAATGAAGACAACCTAACAGGGGAAGATGTT- CGCG AAGGCTTAACTGCAGTTATCTCAGTTAAACACCCAAATCCACAG- TTTGAAGGACA-6 TCCTTCAAAC [T (BHQ-1)] GTGGATTTGGGTGT-3 '(SEQ ID NO: 2) SP_TSG (21) 5' - [6-FAM] TCCTTCAAACTGTGGATTTGGG [T (BHQ- 1)] GT-3 '(SEQ ID NO: 3) (The number 9 or 21 in parentheses means the nucleotide distance between a reporter molecule and a fluorescence inhibiting molecule) A. Nucleic acid synthesis reaction with denaturation, hybridization and primer extension using DNA polymerase that does not have exonuclease activity 5 'to 3'
[000261] The nucleic acid synthesis reaction was conducted in the final volume of 20 μl containing 2 pmols of the mold (SEQ ID NO: 1), 2 μl of 10X Stoffel buffer [containing 100 mM Tris-HCl (pH 8.3 ) and 100 mM KCl], 1 unit of AmpliTaq® DNA polymerase, Stoffel Fragment (Applied BioSystems, USA), 200 μM each of the four dNTPs (dATP, dCTP, dGTP and dTTP), 5 mM MgCl2 and 5 pmols of TSG primer (SEQ ID NO: 2 or 3); the tube containing the reaction mixture was placed in the thermocycler in real time (CFX96, Bio-Rad); the reaction mixture was denatured for 2 min at 95 ° C and subjected to 40 cycles of 30 s at 94 ° C and 60 s at 50 ° C. The detection of the generated signal was carried out in the annealing step (50 ° C) of each cycle.
[000262] In Fig. 12 showing the results after normalization, the signal modifications were not observed even in the presence of the mold (Nos. 1 and 5) where the Stoffel Fragment without intrinsic activity 5 'to 3' of exonuclease was used as a DNA polymerase.
[000263] These results indicate that the signal intensity generated only by hybridization and primer extension was not transformed in the reaction cycles because the template was not amplified during the nucleic acid reaction.
[000264] Therefore, it would be recognized that only the hybridization and extension of a TSG primer in cyclic nucleic acid synthesis reactions are not able to accumulate detectable signals even in the presence of the target nucleic acid sequences (Nos. 1 and 5). B. Nucleic acid synthesis reaction with repeat denaturation, hybridization and primer extension using DNA polymerase having exonuclease activity 5 'to 3'
[000265] The nucleic acid synthesis reaction was carried out in the final volume of 20 μl containing 2 pmols of the mold (SEQ ID NO: 1), 10 μl of DiastarTaq PCR Master Mix 2X (Solgent, Korea) containing [12 mM MgCl2, DiastarTaq PCR buffer, 2 U of DiastarTaq DNA polymerase and dNTP mixture], 5 pmols of TSG primer (SEQ ID NO: 2 or 3); the tube containing the reaction mixture was placed in the thermal cycler in real time (CFX96, Bio-Rad); the reaction mixture was denatured for 15 min at 95 ° C and subjected to 40 cycles of 30 s at 94 ° C and 60 s at 50 ° C. The detection of the generated signal was carried out in the annealing step (50 ° C) of each cycle.
[000266] As shown in Fig. 12, signal modifications of S. pneumoniae were observed (Nos. 3 and 7) where Taq DNA polymerizes having the 5 'to 3' exonuclease activity was used as a DNA polymerase.
[000267] These results indicate that the use of the mold-dependent polymerase having 5 'to 3' exonuclase activity is capable of inducing 5 'cleavage reaction at the 5' end portion of the TSG primer. Consequently, the signals from the labeled fragments released from the TSG primers are generated and accumulated in each cycle, resulting in the observable signals that indicate the presence of the target nucleic acid sequence (Nos. 3 and 7).
[000268] At the same time, the TSG primer (SEQ ID NO: 2) which has a 9 nucleotide reporter molecule away from an inhibitor molecule showed lower Ct values than the TSG primer (SEQ ID NO: 3) which it has a reporter molecule 21 nucleotides away from an inhibitor molecule. These results suggest that TSG primers of shorter length between a reporter and an inhibitor show greater changes in an extent of inhibition before and after 5 'cleavage reaction than those of greater length between a reporter and an inhibitor. EXAMPLE 5: Examination of the TSG primer with DNA polymerase having exonuclease activity 5 'to 3' under real-time PCR reaction conditions for the detection of a target nucleic acid
[000269] We are still examining whether the TSG primer can generate enough signal to detect a target nucleic acid sequence during the real-time PCR reaction using a mold-dependent polymerase nucleic acid having 5 'to 3' exonuclease activity .
[000270] To examine this assessment, the same templates and primers used in Example 2 were used except for the template-dependent polymerase nucleic acid having exonuclease activity 5 'to 3' and the reaction conditions. A. Real-time PCR for the detection of S. pneumoniae
[000271] Real-time PCR was conducted on the final 20 μl volume containing 10 ng of S. pneumoniae genomic DNA, 10 μl of DiastarTaq PCR Master Mix 2X (Solgent, Korea) containing [12 mM MgCl2, DiastarTaq buffer PCR, 2 U of DiastarTaq DNA polymerase and dNTP mixture], 5 pmols of the sense primer (SEQ ID NO: 7) and 5 pmols of the TSG primer (SEQ ID NO: 2 or 3) as a reverse sense primer ; the tube containing the reaction mixture was placed in the thermocycler in real time (CFX96, Bio-Rad); the reaction mixture was denatured for 15 min at 95 ° C and subjected to 30 cycles of 30 s at 94 ° C, 60 s at 55 ° C and 10 s at 72 ° C. The detection of the generated signal was performed in the annealing step (55 ° C) of each cycle.
[000272] As shown in Fig. 13, fluorescent signals from S. pneumoniae were observed in the presence of the S. pneumoniae template (Nos. 1 and 3), whereas there was no fluorescent signal in the negative controls without the template ( Nos. 2 and 4).
[000273] In addition, the TSG primer (SEQ ID NO: 3) which has a 21 nucleotide reporter molecule away from an inhibitor molecule showed lower Ct values and higher RFU values than the TSG primer ( SEQ ID NO: 2) which has a 9 nucleotide reporter molecule away from an inhibitor molecule. B. Real-time PCR for the detection of S. aureus
[000274] The real-time PCR reaction was conducted as the protocol used for the detection of S. pneumoniae, except for the template (S. aureus), sense primer (SEQ ID NO: 8) and TSG primers (SEQ ID NO: 5 or 6) as antisense primers.
[000275] As shown in Fig. 14, the fluorescent signals of S. aureus were observed in the presence of the S. aureus mold (Numbers 1 and 3), whereas there was no fluorescent signal in the negative controls without the mold (Nos 2 and 4). In addition, the TSG primer (SEQ ID NO: 6) that has a 21 nucleotide reporter molecule away from an inhibitor molecule showed lower Ct values and higher RFU values than the TSG primer (SEQ ID NO: 5 ) which has a 6 nucleotide reporter molecule away from an inhibitor molecule. C. Real-time PCR for the detection of N. gonorrhoeae
[000276] The real-time PCR reaction was conducted as the protocol used for the detection of S. pneumoniae, except for the template (N. gonorrhoeae), sense sense primer (SEQ ID NO: 9) and TSG primers (SEQ ID NO: 10 or 11) as antisense primers.
[000277] As shown in Fig. 15, the fluorescent signals of N. gonorrhoeae were observed in the presence of the mold of N. gonorhoreae (Nos. 1 and 3), whereas there was no fluorescent signal in the negative controls without the mold (Nos. 2 and 4). In addition, the TSG primer (SEQ ID NO: 11) that has a 22 nucleotide reporter molecule away from an inhibitor molecule showed lower Ct values and higher RFU values than the TSG primer (SEQ ID NO: 10 ) which has a 4 nucleotide reporter molecule away from an inhibitor molecule. D. Real-time PCR for the detection of N. meningitidis
[000278] The real-time PCR reaction was conducted as the protocol used for the detection of S. pneumoniae, except for the template (N. meningitidis), antisense primer (SEQ ID NO: 12) and TSG primers (SEQ ID NO: 13 or 14) as direct sense initiators.
[000279] As shown in Fig. 16, the fluorescent signals of N. meningitidis were observed in the presence of the N. meningitidis template (Numbers 1 and 3), whereas there was no fluorescent signal in the negative controls without the template (Nos. 2 and 4). In addition, the TSG primer (SEQ ID NO: 14) which has a 20 nucleotide reporter molecule away from an inhibitor molecule showed lower Ct values and higher RFU values than the TSG primer (SEQ ID NO: 13 ) which has a 7 nucleotide reporter molecule away from an inhibitor molecule.
[000280] Finally, where a template-dependent DNA polymerase having 5 'to 3' nuclease activity is used, signals indicative of the presence of the target nucleic acid sequence can be present in two other ways: (i) signal generation by not inhibition of the signal from the interactive marker system in the TSG primer caused by the conformation modification in hybridization with the target nucleic acid sequence; and (ii) signal generation by 5 'cleavage reaction at its 5' end portion of the TSG primer by the mold-dependent nucleic acid polymerase having 5 'to 3' nuclease activity. EXAMPLE 6: Real-time PCR sensitivity using the TSG and DNA polymerase primer having 5 'to 3' exonuclease activity for the detection of S. aureus
[000281] The real-time PCR sensitivity using the TSG and DNA polymerase primer having 5 'to 3' exonuclease activity was tested by detecting the target nucleic acid sequences of the S. aureus gene. To examine this assessment, the same templates and primers used in Example 3 were used except for template-dependent nucleic acid polymerase having exonuclease activity 5 'to 3' and reaction conditions.
[000282] Real-time PCR was conducted in the final 20 μl volume containing diluted genomic DNA (from 100 pg to 10 fg; 10-fold dilution) of S. aureus genomic DNA, 10 μl of QuantiTect Multiplex PCR Master Mix 2X (Qiagen) containing [11 mM MgCl2, Quanti- Tect Multiplex PCR buffer, HotstartTaq DNA polymerase and dNTP mix], 5 pmols of the sense primer (SEQ ID NO: 8) and 5 pmols of the TSG initiator (SEQ ID NO: 6) as an antisense initiator; the tube containing the reaction mixture was placed in the thermocycler in real time (CFX96, Bio-Rad); the reaction mixture was denatured for 15 min at 95 ° C and subjected to 40 cycles of 30 s at 94 ° C, 60 s at 55 ° C and 10 s at 72 ° C. The detection of the generated signal was performed in the annealing step (55 ° C) of each cycle.
[000283] As shown in FIG. 17, when real-time PCR was performed using the serial dilution of S. aureus genomic DNA as described in Fig. 11, it can detect the target nucleic acid sequence up to 100 fg (Nos. 1 to 4). EXAMPLE 7: Evaluation of the TSG primer for target detection of the nucleic acid sequence on the chip
[000284] When the target nucleic acid sequence of the S. pneumoniae gene is used as a template, the sequences of the synthetic template and TSG primers used in this Example are: SP_T105 5'- TTACTGAAAGACAATGAAGACAACCTAACAGGGGAAGATGTT- CGCG AAGGCTTAACTGCACTACTA '(SEQ ID NO: 1) SP_TSG (21) _S 5'- [Ami-noC6] TTTTT [T (Fluorescein)] CCTTCAAACTGTGGATTTGGG [T (BHQ-1)] GT (SEQ ID NO: 15) (The number 21 nos parentheses means the distance of nucleotides between a reporter molecule and a fluorescence-inhibiting molecule) A. Immobilization of the TSG primer on a chip slide
[000285] The TSG primer (SEQ ID NO: 15) was dissolved at a final concentration of 50 µM in Genorama Spotting Solution Type I. The dissolved TSG primer was placed on a glass slide (Ge-norama, Estonia) at room temperature and relative humidity of 70%. The slide was incubated in a humid chamber at 37 ° C for 2 hours. Then, the slide was soaked in a 1% ammonia solution for 10 minutes, followed by washing with distilled water at room temperature. B. Nucleic acid synthesis reaction on the chip
[000286] The nucleic acid synthesis reaction was carried out in the final volume of 20 μl containing 2 pmols of the mold (SEQ ID NO: 1), 2 μl of 10X Stoffel buffer [containing 100 mM Tris-HCl (pH 8.3 ) and 100 mM KCl], 1 unit of AmpliTaq® DNA polymerase, Stoffel Fragment (Applied BioSystems, USA), 200 μM each of the four dNTPs (dATP, dCTP, dGTP and dTTP), 5 mM MgCl2; the reaction mixture was transferred to the slide. The slide was placed in the PCR machine in situ (GeneAmp in situ, Perkin Elmer); the slide was incubated for 2 min at 95 ° C for denaturation and subjected for 40 min at 50 ° C. After a nucleic acid synthesis reaction, the slide was washed (at 70 ° C) and the slide signals were detected by a microarray scanner (ScanArray4000, Perkin Elmer), followed by image analysis.
[000287] Having described a preferred embodiment of the present invention, it should be understood that variants and modifications thereof that are included in the spirit of the invention may be evident to those skilled in this technique, and the scope of this invention must be determined by the added claims and their equivalent.

权利要求:
Claims (21)
[0001]
1. Method for detecting a target nucleic acid sequence from DNA or a mixture of nucleic acids using a target signal generation primer (TSG primer), characterized by the fact that it comprises the steps of: (a) hybridizing the target nucleic acid sequence to the TSG primer to generate and obtain a signal indicative of the presence of the target nucleic acid sequence; wherein the TSG primer comprises (i) a hybridizing nucleotide sequence complementary to the target nucleic acid sequence and (ii) a reporter molecule and a fluorescence inhibitory molecule; wherein the TSG primer does not have a self-complementing sequence that is functional in the formation of a staple loop structure over its entire length; wherein when the TSG primer is not hybridized to the target nucleic acid sequence, the reporter molecule and the fluorescence-inhibiting molecule are three-dimensionally adjacent to each other with no help from clamp loop structures to allow the fluorescence-inhibiting molecule to inhibit a signal from the reporter molecule, thus not generating a signal indicative of the presence of the target nucleic acid sequence; wherein when the TSG primer is hybridized to the target nucleic acid sequence, the reporter molecule and the fluorescence-inhibiting molecule are three-dimensionally separated to allow the fluorescence-inhibiting molecule not to inhibit the signal from the reporter molecule, thereby generating the indicative signal the presence of the target nucleic acid sequence with the reporter molecule and the inhibitory molecule that remains attached to the TSG primer; wherein a mold-dependent nucleic acid polymerase that exhibits a 3 'to 5' nucleasse activity and the TSG primer comprises at least one incompatible nucleotide sequence at its 3 'or 3' end portion, the incompatible nucleotide sequence is not features marker; (b) contacting the resultant of step (a) with a mold-dependent nucleic acid polymerase under primer extension conditions such that the 3 'extension reaction at the 3' end of the TSG primer is induced; and (c) detecting the signal indicating the presence of the target nucleic acid sequence, whereby the signal indicates the presence of the target nucleic acid sequence in the DNA or in the mixture of nucleic acids.
[0002]
Method according to claim 1, characterized in that when the template-dependent nucleic acid polymerase in step (b) has a 5 'to 3' nuclease activity, a portion of the TSG primers are additionally cleaved at its end 5 'by the 5' to 3 'nuclease activity of the template-dependent polymerase nucleic acid.
[0003]
3. Method according to claim 1, characterized by the fact that the method further comprises the repetition of steps (a) - (b) or (a) - (c) with denaturation between repetition cycles at least twice to amplify the signal indicative of the presence of the target nucleic acid sequence.
[0004]
Method according to claim 1 or 2, characterized in that the reporter molecule or the fluorescence inhibitory molecule in the TSG primer is located at its 5 'or 1 to 5 nucleotides away from its 5' end.
[0005]
Method according to claim 1, characterized in that the inhibitor molecule is fluorescent and the signal indicating the presence of the target nucleic acid sequence to be detected in step (c) is a signal from the fluorescent fluorescent inhibitor molecule .
[0006]
Method according to claim 1, characterized in that the mold-dependent nucleic acid polymerase is a mold-dependent nucleic acid polymerase that has an exonuclease activity 3 'to 5'.
[0007]
Method according to claim 6, characterized in that the TSG primer has at least one incompatible nucleotide having a backbone resistant to 3 'to 5' exonuclease activity of the mold-dependent nucleic acid polymerase at its end portion 3 '.
[0008]
Method according to claim 1, characterized in that the method is carried out in solid phase and the TSG initiator is immobilized on the surface of a solid substrate by its 5 'end.
[0009]
Method according to claim 1 or 8, characterized in that the target nucleic acid sequence comprises at least two types of nucleic acid sequences and the TSG primers comprise at least two types of primers.
[0010]
Method according to claim 1 or 8, characterized in that the target nucleic acid sequence comprises a nucleotide variation.
[0011]
11. Method for detecting a target nucleic acid sequence from a DNA or a mixture of nucleic acids using a target signal generation primer (TSG primer) in an amplification reaction, characterized by the fact that comprises the steps of: (a) hybridizing the target nucleic acid sequence with a pair of primers composed of two primers as a sense primer and a sense primer capable of amplifying the target nucleic acid sequence to generate and obtaining a signal indicative of the presence of the target nucleic acid sequence; wherein at least one of the two primers is the TSG primer; wherein the TSG primer comprises (i) a hybridizing nucleotide sequence complementary to the target nucleic acid sequence and (ii) a reporter molecule and a fluorescence inhibitory molecule; wherein the TSG primer does not have a self-complementing sequence that is functional in the formation of a staple loop structure over its entire length; wherein when the TSG primer is not hybridized to the target nucleic acid sequence, the reporter molecule and the fluorescence-inhibiting molecule are three-dimensionally adjacent to each other with no help from clamp loop structures to allow the inhibitor molecule to fluorescence inhibits a signal from the reporter molecule, thus not generating a signal indicative of the presence of the target nucleic acid sequence; wherein when the TSG primer is hybridized to the target nucleic acid sequence, the reporter molecule and the fluorescence-inhibiting molecule are three-dimensionally separated to allow the fluorescence-inhibiting molecule not to inhibit the signal from the reporter molecule, thereby generating the indicative signal the presence of the target nucleic acid sequence with the reporter molecule and the inhibitory molecule that remains attached to the TSG primer; wherein a template-dependent nucleic acid polymerase that exhibits 3 'to 5' nucleasse activity and the TSG primer comprises at least one incompatible nucleotide sequence at its 3 'or 3' end portion, the incompatible nucleotide sequence is not features marker; (b) contacting the resultant of step (a) with a mold-dependent nucleic acid polymerase under primer extension conditions such that the 3 'extension reaction at the 3' ends of the two primers is induced; (c) denaturing the resultant from step (b); (d) repeating steps (a) - (c) at least twice to amplify both the target nucleic acid sequence and the signal indicating the presence of the target nucleic acid sequence; and (e) detection of the signal indicating the presence of the target nucleic acid sequence, in which the detection is carried out for each repetition cycle of step (d), at the end of the repetition of step (d) or in each of the intervals predetermined times during the repeat, such that the signal indicates the presence of the target nucleic acid sequence.
[0012]
Method according to claim 11, characterized in that when the template-dependent nucleic acid polymerase in step (b) has a 5 'to 3' nuclease activity, a portion of the TSG primers are additionally cleaved at its end 5 'by the 5' to 3 'nuclease activity of the mold-dependent nucleic acid polymerase.
[0013]
Method according to claim 11 or 12, characterized in that the reporter molecule or the fluorescence-inhibiting molecule in the TSG primer is located at its 5 'or 1 to 5 nucleotides away from its 5' end.
[0014]
Method according to claim 11, characterized in that the inhibitory molecule is fluorescent and the signal indicating the presence of the target nucleic acid sequence to be detected in step (e) is a signal from the fluorescent fluorescent inhibitor molecule .
[0015]
Method according to claim 11, characterized in that the mold-dependent nucleic acid polymerase is a mold-dependent nucleic acid polymerase that has an exonuclease activity 3 'to 5'.
[0016]
16. Method according to claim 11, characterized in that the method is carried out in solid phase, at least one of the two initiators is immobilized on the surface of a solid substrate by its 5 'end and the immobilized initiator is the initiator of TSG.
[0017]
17. Kit for detecting a target nucleic acid sequence from a DNA or mixture of nucleic acids using a target signal generation primer (TSG primer) for use in the method as defined in any one of claims 1 to 16, characterized by the fact that it comprises: (a) the TSG primer comprising (i) a hybridizing nucleotide sequence complementary to the target nucleic acid sequence and (ii) a reporter molecule and a fluorescence inhibiting molecule; wherein the TSG primer does not have a self-complementing sequence that is functional in forming a staple loop structure over its entire length; wherein when the TSG primer is not hybridized to the target nucleic acid sequence, the reporter molecule and the fluorescence-inhibiting molecule are three-dimensionally adjacent to each other with no help from clamp loop structures to allow the fluorescence-inhibiting molecule to inhibit a signal from the reporter molecule, thereby generating no signal indicative of the presence of the target nucleic acid sequence; where when the TSG primer is hybridized to the target nucleic acid sequence, the reporter molecule and the fluorescence inhibitor molecule are three-dimensionally separated to allow the fluorescence inhibitor molecule not to inhibit the signal from the reporter molecule, whereby the signal indicating the presence of the target nucleic acid sequence is generated and obtained with the reporter molecule and the inhibitory molecule that remains attached to the TSG primer; and (b) a template-dependent nucleic acid polymerase capable of inducing the 3 'extension reaction at the 3' end of the TSG primer acting on a hybridization result between the TSG primer and the target nucleic acid sequence.
[0018]
18. Kit according to claim 17, characterized in that the kit comprises a pair of primers composed of two primers as a forward sense primer and a reverse sense primer capable of amplifying the target nucleic acid sequence ; wherein at least one of the two primers is the TSG primer.
[0019]
19. Kit according to claim 17 or 18, characterized in that the mold-dependent nucleic acid polymerase has a 5 'to 3' nuclease activity to induce both the 3 'extension reaction at the 3' end of the TSG primer for its polymerase activity as for the 5 'cleavage reaction at the 5' end of the TSG primer for its 5 'to 3' nuclease activity.
[0020]
Kit according to any one of claims 17 to 19, characterized in that the reporter molecule or the fluorescence-inhibiting molecule in the TSG primer is located at its 5 'or 1 to 5 nucleotides away from its 5' end .
[0021]
21. The kit of claim 17 or 18, characterized in that the mold-dependent nucleic acid polymerase is a mold-dependent nucleic acid polymerase that has a 3 'to 5' exonuclease activity.

类似技术:

---

公开号 | 公开日 | 专利标题

---

BR112012018394B1|2021-02-23|method for detecting a target nucleic acid sequence and kit for detecting a target nucleic acid sequence

---

US9328377B2|2016-05-03|Detection of target nucleic acid using a target hybridization and detection primer

---

RU2542478C2|2015-02-20|Target-discriminating probe, method of constructing thereof and method of detecting nucleic acid target-sequence |

---

CN106011234B|2019-11-12|Utilize the detection of detection and labeled oligonucleotide cutting and extension-dependent signals conduction oligonucleotide hybridization target nucleic acid sequence

---

US9447457B2|2016-09-20|Detection of target nucleic acid sequences by cyclic exonucleolytic reactions

---

ES2653642T3|2018-02-08|Detection of a target nucleic acid sequence by assay without cleavage-dependent hybridization and extension of PTO

---

US20120258447A1|2012-10-11|Real-time multiplexing detection of target nucleic acid sequences with elimination of false signals

---

BR112013027876B1|2021-06-08|methods for detecting a target nucleic acid sequence and kits for detecting a target nucleic acid sequence

---

WO2013157821A1|2013-10-24|Detection of target nucleic acid sequence by pto cleavage and extension-dependent signaling oligonucleotide cleavage

---

KR20110048734A|2011-05-12|5-mismatch probe target detection

同族专利:

---

公开号 | 公开日

---

CA2784344C|2018-01-02|

---

US20120264643A1|2012-10-18|

---

RU2012129362A|2014-01-27|

---

CN102762744A|2012-10-31|

---

EP2516679A4|2013-05-22|

---

KR101569476B1|2015-11-16|

---

EP2516679A1|2012-10-31|

---

AU2010336137A1|2012-07-12|

---

KR20120107488A|2012-10-02|

---

US9845492B2|2017-12-19|

---

EP2516679B1|2017-08-23|

---

RU2551321C2|2015-05-20|

---

WO2011078441A1|2011-06-30|

---

JP5822843B2|2015-11-24|

---

IL220478D0|2012-08-30|

---

CA2784344A1|2011-06-30|

---

AU2010336137B2|2015-08-06|

---

JP2013514803A|2013-05-02|

---

IL220478A|2016-09-29|

---

CN102762744B|2017-07-25|

---

BR112012018394A2|2017-01-10|

---

BR112012018394B8|2021-07-27|

引用文献:

---

公开号 | 申请日 | 公开日 | 申请人 | 专利标题

---

---

US3996345A|1974-08-12|1976-12-07|Syva Company|Fluorescence quenching with immunological pairs in immunoassays|

---

US4351760A|1979-09-07|1982-09-28|Syva Company|Novel alkyl substituted fluorescent compounds and polyamino acid conjugates|

---

US4683202B1|1985-03-28|1990-11-27|Cetus Corp|

---

US4683195B1|1986-01-30|1990-11-27|Cetus Corp|

---

US4800159A|1986-02-07|1989-01-24|Cetus Corporation|Process for amplifying, detecting, and/or cloning nucleic acid sequences|

---

IL86724A|1987-06-19|1995-01-24|Siska Diagnostics Inc|Method and kits for the amplification and detection of nucleic acid sequences|

---

AU624601B2|1988-01-21|1992-06-18|Genentech Inc.|Amplification and detection of nucleic acid sequences|

---

US5210015A|1990-08-06|1993-05-11|Hoffman-La Roche Inc.|Homogeneous assay system using the nuclease activity of a nucleic acid polymerase|

---

US5538848A|1994-11-16|1996-07-23|Applied Biosystems Division, Perkin-Elmer Corp.|Method for detecting nucleic acid amplification using self-quenching fluorescence probe|

---

US6117635A|1996-07-16|2000-09-12|Intergen Company|Nucleic acid amplification oligonucleotides with molecular energy transfer labels and methods based thereon|

---

US6485901B1|1997-10-27|2002-11-26|Boston Probes, Inc.|Methods, kits and compositions pertaining to linear beacons|

---

ES2290979T3|1997-12-15|2008-02-16|Csl Behring Gmbh|PRIMER MARKED FOR USE IN THE DETECTION OF NUCLEIC ACIDS DIANA.|

---

GB9812768D0|1998-06-13|1998-08-12|Zeneca Ltd|Methods|

---

US6383752B1|1999-03-31|2002-05-07|Hybridon, Inc.|Pseudo-cyclic oligonucleobases|

---

US6322980B1|1999-04-30|2001-11-27|Aclara Biosciences, Inc.|Single nucleotide detection using degradation of a fluorescent sequence|

---

US6277607B1|1999-05-24|2001-08-21|Sanjay Tyagi|High specificity primers, amplification methods and kits|

---

US7537886B1|1999-06-22|2009-05-26|Life Technologies Corporation|Primers and methods for the detection and discrimination of nucleic acids|

---

US7205105B2|1999-12-08|2007-04-17|Epoch Biosciences, Inc.|Real-time linear detection probes: sensitive 5′-minor groove binder-containing probes for PCR analysis|

---

US7344830B2|2000-09-26|2008-03-18|Health Research Inc.|Heteroduplex tracking assay|

---

US6699670B2|2001-03-01|2004-03-02|The Johns Hopkins University|Quantitative assay for the simultaneous detection and speciation of bacterial infections|

---

US20060057561A1|2001-06-14|2006-03-16|Hart Keith W|Virus detection method, primers therefor and screening kit|

---

US7205112B2|2001-06-27|2007-04-17|University Of South Florida|Materials and methods for detection of enterovirus and norovirus|

---

CN1483076A|2001-10-26|2004-03-17|松下电器产业株式会社|Method of detecting target nucleic acid and nucleic acid probe|

---

US6818420B2|2002-02-27|2004-11-16|Biosource International, Inc.|Methods of using FET labeled oligonucleotides that include a 3′-5′ exonuclease resistant quencher domain and compositions for practicing the same|

---

US20070059690A1|2002-05-31|2007-03-15|Amirul Islam|"Met/fret based method of target nucleic acid detection whereby the donor/acceptor moieties are on complementary strands"|

---

JP3923917B2|2003-03-26|2007-06-06|株式会社東芝|Target production method, target sequence detection method, target and target sequence detection assay kit|

---

US20070141572A1|2003-04-18|2007-06-21|Eliane Ubalijoro|Polynucleotides for the detection of listeria moncytogenes|

---

EP1687609B1|2003-10-28|2014-12-10|Epoch Biosciences, Inc.|Fluorescent probes for dna detection by hybridization with improved sensitivity and low background|

---

US7667024B2|2003-11-19|2010-02-23|Allelogic Biosciences Corp.|Oligonucleotides labeled with a plurality of fluorophores|

---

GB0423552D0|2004-10-22|2004-11-24|Hepcgen Ltd|Methods|

---

KR100977186B1|2005-03-05|2010-08-23|주식회사 씨젠|Processes Using Dual Specificity Oligonucleotide and Dual Specificity Oligonucleotide|

---

EP1896602A4|2005-06-09|2009-08-12|Epoch Biosciences Inc|Improved primer-based amplification methods|

---

CA2579918A1|2005-06-16|2006-12-28|Biotools Biotechnological & Medical Laboratories, S.A.|Nucleic acid detection method involving the direct generation of a measurable signal|

---

EP1907586A2|2005-07-15|2008-04-09|Applera Corporation|Detection of nucleic acid amplification|

---

AU2006339057B2|2005-07-25|2011-09-22|Abbott Diagnostics Scarborough, Inc.|Methods for multiplexing recombinase polymerase amplification|

---

US20090068643A1|2005-11-23|2009-03-12|Integrated Dna Technologies, Inc.|Dual Function Primers for Amplifying DNA and Methods of Use|

---

US20070254284A1|2006-05-01|2007-11-01|Biwei Zhao|A nucleic acid detection method|

---

GB0609498D0|2006-05-12|2006-06-21|Oncomethylome Sciences S A|Novel methylation marker|

---

GB0703997D0|2007-03-01|2007-04-11|Oxitec Ltd|Methods for detecting nucleic sequences|

---

KR20110050327A|2009-11-07|2011-05-13|주식회사 씨젠|T h d primer target detection|US20120058481A1|2010-08-20|2012-03-08|Life Technologies Corporation|Quantitative Real Time PCR Assay Using FRET Dual-Labeled Primers|

---

MX340258B|2011-01-11|2016-07-01|Seegene Inc|Detection of target nucleic acid sequences by pto cleavage and extension assay.|

---

CN103534358B|2011-03-29|2015-03-25|Seegene株式会社|Detection of target nucleic acid sequence by PTO cleavage and extension-dependent cleavage|

---

US9850524B2|2011-05-04|2017-12-26|Seegene, Inc.|Detection of target nucleic acid sequences by PO cleavage and hybridization|

---

KR20130101952A|2012-02-02|2013-09-16|주식회사 씨젠|Detection of target nucleic acid sequence by pto cleavage and extension-dependent hybridization|

---

WO2013126743A1|2012-02-23|2013-08-29|Primeradx, Inc.|Multimodal pcr target detection|

---

JP5976849B2|2012-03-05|2016-08-24|シージーン アイエヌシー|Detection of nucleotide mutations in target nucleic acid sequences by PTO cleavage and extension assays {Detection of Nucleotide Variation on Target Nucleic Acid Sequence PTO Cleavage and Extension Assay}|

---

US9683259B2|2012-04-19|2017-06-20|Seegene, Inc.|Detection of target nucleic acid sequence by PTO cleavage and extension-dependent signaling oligonucleotide cleavage|

---

US9074249B2|2012-06-04|2015-07-07|New England Biolabs, Inc.|Detection of amplification products|

---

US9074243B2|2012-07-27|2015-07-07|New England Biolabs, Inc.|Detection of amplification products|

---

CA2897474A1|2013-01-24|2014-07-31|California Institute Of Technology|Chromophore-based characterization and detection methods|

---

WO2014124290A1|2013-02-07|2014-08-14|Rutgers, The State University Of New Jersey|Highly selective nucleic acid amplification primers|

---

EP2971147A4|2013-03-15|2016-08-31|Abbott Molecular Inc|Multiplex allele detection|

---

JP2017514467A|2014-04-23|2017-06-08|チルドレンズ メディカル センター コーポレーション|High-throughput structure determination using nucleic acid calipers|

---

KR101742681B1|2015-01-30|2017-06-01|에스디 바이오센서 주식회사|A primer for pcr amplification linked with complementary sequences or complementary sequences including mis-matched nucleotides and nucleic acid amplification method using the same|

---

CN105256055B|2015-11-13|2019-02-05|中华人民共和国汕头出入境检验检疫局|Method, primer and the kit of real-time fluorescence PCR detection lactobacillus plantarum based on DPO primer|

---

WO2017105104A1|2015-12-15|2017-06-22|Seegene, Inc.|Signal extraction for a target nucleic acid sequence|

---

CN107091834B|2017-05-24|2019-07-02|青岛科技大学|A method of DNA is detected based on hair fastener mispairing circulation amplifying technique|

---

US20200270679A1|2017-09-29|2020-08-27|Seegene, Inc.|Detection of target nucleic acid sequences by pto cleavage and extension-dependent extension assay|

---

JP2020130094A|2019-02-22|2020-08-31|横河電機株式会社|Nucleic acid sequence measurement device, nucleic acid sequence measurement method, and nucleic acid sequence measurement apparatus|

法律状态:
2019-02-05| B07D| Technical examination (opinion) related to article 229 of industrial property law [chapter 7.4 patent gazette]|Free format text: DE ACORDO COM O ARTIGO 229-C DA LEI NO 10196/2001, QUE MODIFICOU A LEI NO 9279/96, A CONCESSAO DA PATENTE ESTA CONDICIONADA A ANUENCIA PREVIA DA ANVISA. CONSIDERANDO A APROVACAO DOS TERMOS DO PARECER NO 337/PGF/EA/2010, BEM COMO A PORTARIA INTERMINISTERIAL NO 1065 DE 24/05/2012, ENCAMINHA-SE O PRESENTE PEDIDO PARA AS PROVIDENCIAS CABIVEIS. |

---

2019-11-19| B07G| Grant request does not fulfill article 229-c lpi (prior consent of anvisa) [chapter 7.7 patent gazette]|

---

2019-12-03| B06F| Objections, documents and/or translations needed after an examination request according [chapter 6.6 patent gazette]|

---

2020-02-04| B06U| Preliminary requirement: requests with searches performed by other patent offices: procedure suspended [chapter 6.21 patent gazette]|

---

2020-06-02| B06A| Notification to applicant to reply to the report for non-patentability or inadequacy of the application [chapter 6.1 patent gazette]|

---

2020-12-08| B09A| Decision: intention to grant [chapter 9.1 patent gazette]|

---

2021-02-23| B16A| Patent or certificate of addition of invention granted|Free format text: PRAZO DE VALIDADE: 10 (DEZ) ANOS CONTADOS A PARTIR DE 23/02/2021, OBSERVADAS AS CONDICOES LEGAIS. |

---

2021-07-27| B16C| Correction of notification of the grant|Free format text: PRAZO DE VALIDADE: 20 (VINTE) ANOS CONTADOS A PARTIR DE 26/03/2010, OBSERVADAS AS CONDICOES LEGAIS. PATENTE CONCEDIDA CONFORME ADI 5.529/DF, QUE DETERMINA A ALTERACAO DO PRAZO DE CONCESSAO |

优先权:

---

申请号 | 申请日 | 专利标题

---

KR10-2009-0127880|2009-12-21|

---

KR20090127880|2009-12-21|

---

PCT/KR2010/001873|WO2011078441A1|2009-12-21|2010-03-26|Tsg primer target detection|

---